MutScan
MutScan copied to clipboard
OpenGene
Detect and visualize target mutations by scanning FastQ files directly
Command example with vep-annotated VCF as input: ```mutscan -1 R1.fq.gz -2 R2.fq.gz -m VEP.vcf -r ref.a``` outputs: ``` No mutation to be scanned Your VCF contains no valid records ```...
Hi, Shifu @sfchen `html` and the `json` format are good , but the `tsv` format output could be a charming option when performing parsing for the downstream analysis. In addition,...
Is it possible to get a list of readids that support (or not support) a list of known mutations? I have a bunch of T>C mutations from 4sU seq and...
Hi, Thanks for providing mutscan, which is fast enough to generally find the mutations. However, I find it hard to display the variants that are already observed in IGV, mapped...
when use `fastp` + `gencore` , can not use `GATK SamToFastq`. `gencore` copy the flag of R1 reads as R2 reads (or R2 as R1)? For example， Before `gencore` ```...
Hello! I have "chr pos gene ref and alt "and so on ,but I have no "cosmic，STRAND and CNT".How I should do to make a VCF-format mutation file ? Thank...
Hi, We are overall very happy with MutScan, but It seems some reads are missed when `--simplified` is `on` : **R1.fastq :** ``` @NL500104:785:HCMC2AFX5:1:11303:22509:17003 1:N:0:ACAGTGAC+CAGTGACA GGAAAGGGAAGGACTGGGAGAGACACAAAGACCAGAGCCAGCCTCAGGGACAAGAGATTCCAGTTTTAGGCCTTT + AAAAAEEEE6EEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEE//EEAEEEEEEEEE/EEE/EEEE
