velocyto.py
velocyto.py copied to clipboard
velocyto-team
RNA velocity estimation in Python
Hi , my scRNA data is get the cluster results by seurat(all 6 samples),and I want used the tools to calculate all cluster's velocyto results. I already get the loom...
as the velocyto run10x read the possorted_genome_bam.bam, but I found the bam file not exactly sortted by barcode and UMI, here is an example of possorted_genome_bam.bam:  I think if...
Hi， I used this tools to analysis my 10X scRNA data,I got the loom files and combined with the seurat object,which mapped to the UMAP/TSNE dimension reduction results,now I have...
Hi, My input bam files come from a 10X Chromium experiment and have entries with format GTTCCTCCAAGTCGATGGCACCTCCCTCCCTCTCAACCACTTGAG DADBCHII?FGE?DCGGEG1@
I'm now trying to reproduce the results from https://github.com/velocyto-team/velocyto-notebooks/blob/master/python/DentateGyrus.ipynb Unfortunately, vlm.estimate_transition_prob(hidim="Sx_sz", embed="ts", transform="sqrt", psc=1, n_neighbors=2000, knn_random=True, sampled_fraction=0.5) raises warning: FutureWarning: arrays to stack must be passed as a "sequence" type...
Hi, when I try to run velocyto --run smartseq or --run, I found that some genes are filtered during this process. The loom file generated, when read by scanpy, contains...
hi, Can i use velocyto analysis in Spatial transcriptome , like 10X vesium ? thanks
Hi! I have been able to succesfully generate loom files using mouse sc-data but now, 1 week later, I have faced issues running _velocyto run_ on human samples. I am...
Hi,everyone! There is a problem that bothers me recently. PackageNotInstalledError: The R package "princurve" is not installed.But I cannot install this package in python. Thanks in advance for your help!
Hello, Just wondering what the best way would be to approach running velocyto on MARS-seq generated data. Thanks
