fastp
fastp copied to clipboard
OpenGene
An ultra-fast all-in-one FASTQ preprocessor (QC/adapters/trimming/filtering/splitting/merging...)
Minor thing that I've found through trial and error for fastp-v0.19.5 & fastp-v0.20.1 I cannot install the latest version of fastp; different issue: https://github.com/OpenGene/fastp/issues/383#issuecomment-1088442268 Regardless, here is the behavior I've...
Dear all, I am using Mac M1 processor and it is giving me a hard time updating FASTP without conda. With conda I am able to update the FASTP however...
First of all, congratulations on that fantastic tool for its speed. I am not sure if "fastp" automatically detects adapters used by ONT libraries. And what would be the recommended...
There were other issues about memory, but none resolved/addressed what I am seeing. I run fastp 0.23.2 in a stream as follows. ``` fastp \ --stdin --interleaved_in --stdout \ --dont_eval_duplication...
Hello OpenGene team, is there a way to know from the fastp logs how many reads were polyG trimmed? Many thanks! Jorge
The relationship between character and Q score: - !=05 - 4=19 - 5=20 - 6=21 - ?=30 To understand the mechanism of fastp trimming reads, I design a fastq file:...
Sometimes `fastp` detects what could be real genomic repetitive sequence as adaptor, for example: ``` Detected read1 adapter: | AACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACC ``` Has anyone else seen this behaviour? My command was:...
Hey OpenGene team, I am using fastp to trim polyG in NextSeq reads. That is the only filtering I am interested at this point. I am wondering if with these...
Hi all, When I deal with a big fastq file (>20G), it takes long time to generate the .json and .html reports. Is there any way to skip this step...
One of the fastq files I'm processing was carried out using the NEXTflex™ Small RNA-Seq Kit for library prep which uses an adapter sequence with Ns in it NNNNTGGAATTCTCGGGTGCCAAGG I...
