fastp
fastp copied to clipboard
OpenGene
An ultra-fast all-in-one FASTQ preprocessor (QC/adapters/trimming/filtering/splitting/merging...)
I would like to use fastp with input coming over a fifo. Since you're a single pass tool, it appears this should work. But no matter how I try to...
I want to perform WGS analysis using BGI sequence data. To remove BGI sequence adapters, I used fastp and checked for the presence of the adapter sequence using the grep...
Hi, Thanks for the useful tool. I would like to request a new feature/option to come into play when using `fastp` for deduplication. It would be useful if the IDs...
Hi. I noticed that on the SEQanswers forum a document from BGI has been posted that lists all sequences for the oligos and primers used for BGISEQ/DNBSEQ/MGISEQ library preparation. See...
Hi, there We tried to use fastp to do de-duplication. However, we found 2 issues. Looking forward to your reply. 1) one round of de-duplication is ineffective. we ran level...
Dear fastp team, First of all thank you for the tool, very nice! I am running fastp on SE data from a smallRNAseq dataset of 50nt reads, provided the default...
Hello, In my Illumina NovaSeq read, I have many G and C homopolymer reads. I used fastp --trim_poly_g option. However, this option detects reads with at least 10 Gs at...
I've been running fastp as part of a larger third-party pipeline (i.e. not written or maintained by me), and noticed that it was specifying adapter sequences multiple times on the...
Hi, I am using default settings to clean my PE reads using the following default settings: fastp -i Sample_raw_1.fq.gz -I Sample_raw_2.fq.gz -o Sample_clean_1.fq.gz -O Sample_clean_2.fq.gz, But I want to know...
Hi all, I just received Illumina NovaSeq PE sequencing data, and according to the sequencing company, the following adapters were used: ``` Sequences of adapter P5 adapter： P5→P7’(5’→3’) AATGATACGGCGACCACCGAGATCTACAC[i5*]ACACTCTTTCCCTACACGACGCTCTTCCGATCT P7...
