add adapters to known adapters file

[CatarinaCarolina]

Hi all,

I just received Illumina NovaSeq PE sequencing data, and according to the sequencing company, the following adapters were used:

Sequences of adapter

P5 adapter：

P5→P7’(5’→3’)

AATGATACGGCGACCACCGAGATCTACAC[i5*]ACACTCTTTCCCTACACGACGCTCTTCCGATCT

P7 adapter：

P5→P7’(5’→3’)

GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7*]ATCTCGTATGCCGTCTTCTGCTTG

*i5/i7 represent index sequences. They are provided here to show the complete adapter structure. Requirements for including or excluding indices in adapter trimming software may vary.

I can find fragments, but not the entirety of the adapters, in the https://github.com/OpenGene/fastp/blob/master/src/knownadapters.h file. Could you check if these need adding, and if so, add them?

Kindly, Catarina

[sfchen]

can you run the new fastp to check whether fastp can detect the adapter correctly?