fusioncatcher
fusioncatcher copied to clipboard
ndaniel
Finder of Somatic Fusion Genes in RNA-seq data
Hi Daniel, I got this error message for some samples: ``` Memory: max=211237m, total=211237m, free=207740m, used=3497m Input is being processed as paired Started output streams: 0.070 seconds. Warning! Changed from...
hello Daniel, I just tried downloading the data using the docker run, however it seems to be not working as expected. `docker run -v /apps/reference/:/data quay.io/biocontainers/fusioncatcher:1.33--hdfd78af_0 download-human-db.sh .` outputs: ```...
This issue is similar to #82 from 2018, except it could not be solved by changing servers, so the root cause might be something different this time. The latest version...
I am currently working with a series of human samples in which the fusion between BCL2 (chr18 ~63 Mbp) and IGH@ (chr14 ~105 Mbp) is recurring and pertinent. It appears...
Hi Daniel, We noticed an inconsistency between the Fusion_sequence and the protein sequence. It is a fusion between HEG1 and SLC12A8, and the reported fusion sequence is ``` TCGGGATACTTTCAGTTCAACAAGATGGACCACTCCTGCCGAG*AACATGGTTTCATTGGATATTCACCCGAACTGCTACAGAACAA ```...
Hi Daniel, We noted an an instance in which FusionCatcher reported a long sequence of Ks in the predicted fusion protein. When we tried to reconstruct the protein sequence we...
Hi! I'm trying to run FusionCatcher v1.33 and I get an error: ``` //////////////////////////////////////////////////////////////////////////////// Running: step = 78 Time: 12:53 Date: 2022-09-17 (elapsed time: 0d:0h:7m) \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\ ==> Current working directory:...
in the output file of fusioncatcher, what does not-converted mean when it represents the fusion position column?
Hello fusioncatcher tools, eg `fusioncatcher.py`, `blat_parallel.py`, `overlap.py`, ... uses multiprocessing.cpu_count() to ge the numebr of available cpusbut multiprocessing.cpu_count() is the number of cpu in the machine. But this is not...
Hi, I am running fusioncatcher v1.33 for a set of RNA-Seq data. I noticed that the output file for many of the samples contain fusions with **t3**, **t4**, **t7** tags...
