Filipe G. Vieira

Results 123 issues of Filipe G. Vieira

Dear all, is it possible to subsample direclty from an interleaved fastq file? I know I can sample both files separately with the same seed and then merge them, but...

**Snakemake version** `v7.12.1` **Describe the bug** There seems to be an issue when using `multiext` with suffixes that do not start with a `.`, and `--cache`. When running example 1...

bug

When running the output `.svaba.unfiltered.somatic.sv.vcf` vcf file through `bcftools`, I get the warnings: ``` [W::bcf_hdr_check_sanity] PL should be declared as Number=G [W::vcf_parse] FILTER 'BLACKLIST' is not defined in the header...

I'm runnning `svaba` to call somatic SV with a matched blood on 9 samples, like: ``` svaba run --threads 30 --reference-genome GCA_000001405.15_GRCh38_no_alt_analysis_set.fna --blacklist blacklist.bed --tumor-bam tumor.cram --normal-bam normal.cram --id-string temp/tumor...

I've just run `SvABA` on a small region of chr X, but the results are quite difficult to interpret just from the VCF files. I tried looking at the `*.alignments.txt.gz`...

How does VSEARCH scores alignments on masked regions? I would expect it to discard hits between masked regions but, when clustering the sequences: ``` >HWI-ST397:349:C2YYMACXX:3:1102:20033:76341 TGCATAATAAGGAAAAGGCAGAACTCTTACTGTATTAGAATTTCAAATGAAAAAGTATATACATTTGTGTGCATATACATATATATATACA >HWI-ST397:349:C2YYMACXX:3:2103:12330:15129 TGCATATGCATATATATATACACACACCCACGTGTATCTATACTATATAGAATATCTATCTAGTATGCA ``` with...

Installed `quast` from `bioconda` but, when running it with some `pacbio` reads, got an error because it could not compile `bwa`: ``` Running Reads analyzer... Compiling BWA (details are in...

Dear all, I've been trying to use `fgbio CorrectUmis` to process some data from Illumina's TSO500, but they use a mixture of 6bp and 7bp UMIs. Since `bcl2fastq` needs a...

help wanted
question

Dear all, running `delly` with an empty BED gives an error: ``` Exclude file is missing: [...] ``` Would it be possible to, when BED file is empty, to just...

enhancement

Dear all, would it be possible to get more detailed per-site info for QC? Right now somalier outputs only per sample and pairs of samples info. There is already something...