mirna
mirna copied to clipboard
microRNA profiling pipeline
Hi, I have recently started working on miRNAseq analysis and would like to follow your pipeline. I have the reads trimmed and aligned as per your suggestions. In the next...
Hi I have downloaded scripts from [http://www.bcgsc.ca/platform/bioinfo/software/adapter-trimming-for-small-rna-sequencing](url). When I run this script by using `perl adapter_trim.pl -a TACTCTCGTATGCCGTCTTCTG SRRxxxx.fastq.gz` command, the program took a long time to run without stopping....
Hello, we have been working with the TCGA isoform.quantification files for a while until we realized that it seems like the chromosomal end position annotated in that file does not...
Hi there, I'm using this pipeline to build our in-house mirna tools, but seems like if we use D. melanogaster with species code:dme and genome data dm6, it will generate...