mirna
mirna copied to clipboard
How to use Pre-alignment processing perl script?
Hi
I have downloaded scripts from http://www.bcgsc.ca/platform/bioinfo/software/adapter-trimming-for-small-rna-sequencing. When I run this script by using perl adapter_trim.pl -a TACTCTCGTATGCCGTCTTCTG SRRxxxx.fastq.gz
command, the program took a long time to run without stopping. I don't understand how to deal with this problem, would you like to show a detail tutorial about trimming adpator process?
And another question is the following http link http://www.bcgsc.ca/platform/bioinfo/software/adapter-trimming-for-small-rna-sequencing is not available now, would you like to give a new http link?
Thank you very much for your help
lushuyangming