Anton Petrov
Anton Petrov
Add a URL parameter with query sequence that will be inserted into the sequence search input _textarea_: `/sequence-seach?query-sequence=ACGUACGUAGCACGUAGCUAG` The sequence length is limited to the maximum URL length supported by...
- [ ] add help pages with documentation about how to add RNAcentral tracks to Ensembl and UCSC browsers - [ ] investigate if RNAcentral Track Hubs can be loaded...
Sarah found a bug in the genome browser! If you change the location by dragging the browser and then switch to a different species, the species in the URL is...
- [ ] RNA type pie chart (e.g. database X has 30% snoRNA, 70% lncRNA) - [ ] pie chart with other databases that link to the same sequences (e.g....
Example page: https://rnacentral.org/rna/URS00001310DE/9606 Steps to reproduce: 1. Click on the second `Go to location` button - it will load the genome location 2. Click on the first `Go to location`...
### Background To make it easier for users to perform precise searches without knowing Lucene syntax or selecting facets, we can implement **autocomplete by category** similar to how it is...
It looks like some links can be established using external ids: https://www.ncbi.nlm.nih.gov/gene/?term=S000007287 However, the FTP archive contains files like `gene2accession.gz`, `gene2ensembl.gz` etc so we can get more robust links using...
- Streamline using custom templates (#129) - GitHub Codespaces integration (#127) - Consistent use of `--quiet` (#129) - Bug fixes and docs improvements (fix #121) - Rfam version 14.10 (https://github.com/RNAcentral/R2DT/pull/132)...
The [RNA 2D JSON Schema](https://github.com/LDWLab/RNA2D-data-schema) is switching from absolute to relative coordinates. This means that the code that uses R2DT JSON output needs to be updated or the SVG images...