Link to RNAcentral sequence search with sequence preloaded in search box

[AntonPetrov]

Add a URL parameter with query sequence that will be inserted into the sequence search input textarea: /sequence-seach?query-sequence=ACGUACGUAGCACGUAGCUAG The sequence length is limited to the maximum URL length supported by the browsers.

This is a request from a user at ISMB who develops a pipeline for discovering new small RNAs and wants to link to RNAcentral so that they can launch searches against RNAcentral from their UI. We could also use this feature when someone types a query like ACGUACGUAGCACGUAGCUAG in the text search box.