xiucz

Please check your input file type.

@edceeyuchen Hi, can you please use this version https://github.com/GavinHaLab/ichorCNA instead? It seems that the GitHub repository is no longer maintained. I apologize for any confusion. What I meant is that...

Hello, @shiquan Version: 1.0.9 I get a 1M window bed file here, but the error still shows. ``` $ bedtools makewindows -b ucsc.hg19.WGS.bed -w 1000000 > ucsc.hg19.fasta.1000000.bed $ bamdst/bamdst -o...

It works now, thank you!

Thanks for your reply. I grep one read here. arriba ``` $ samtools view Aligned.sortedByCoord.out.bam|grep V350121616L4C005R0660558367 V350121616L4C005R0660558367 99 chr10 51381825 255 22M2452N59M3295N69M = 51387704 351037 GGTCCAAACCAGGAAATGTACAGATTTTGAATATGGTGACTAGGCAAGGGGCACTTTGGGCTAATACTCTAGGTTCTCTGGCGTTGCTCTATAGTGCATTTGGTGTCATCATTGAGAAAACACGAGGTGCAGAAGATGACCTTAACACAG FFFFGGFF>FFF

Thanks for your reply, I grep one soft-clip read in STARfusion. arriba ``` $samtools view Aligned.sortedByCoord.out.bam|grep V350121616L4C005R0660558367 V350121616L4C005R0660558367 99 chr10 51381825 255 22M2452N59M3295N69M = 51387704 351037 GGTCCAAACCAGGAAATGTACAGATTTTGAATATGGTGACTAGGCAAGGGGCACTTTGGGCTAATACTCTAGGTTCTCTGGCGTTGCTCTATAGTGCATTTGGTGTCATCATTGAGAAAACACGAGGTGCAGAAGATGACCTTAACACAG FFFFGGFF>FFF

Thank you, and I will provide further information if I have any.

In the end, I could not further validate this sample. However, the same fusion event was detected in the WBC of the patient, leading me to believe that STARfusion's fusion...

Hi, @ChitrArpita You can prepare your mappability file like this. ``` readLength=150 gem-indexer -i ucsc.hg19.fasta -o ucsc.hg19.mappability -T 12 gem-mappability -m 2 -I ucsc.hg19.mappability.gem -l ${readLength} -o ucsc.hg19.mappability.${readLength}mer -T 12...

@jgarces02 Not yet, ichorCNA or CNVpytor may be a good choice.