Daniel Nicorici

Does the ``test.sh`` from FusionCatcher run fine?

Hi @phoenix1391 How many input FASTQ files are there? How long the reads are?

Hi, sorry but FusionCatcher does not support single end reads of 100bp long. Cheers, Daniel

Velvet is not needed by FusionCatcher (if the default options are used). So probably it should be removed.

Hi @zhuchcn Sorry, the easy way would be to find someone which has those built files corresponding to some older version of FusionCatcher. It is not easy feature to backtrak...

This will be fixed in the next official release.

Thanks for reporting the bug! Indeed the IGH@-BCL2 fusions are very interesting. Looking to attached files which looks something like this: ``` BCL2-IGH@ BOWTIE+SPOTLIGHT 18:63126312:- 14:63187169: GCCCTCCTGCCCTCCTTCCGCTCCAG*GGGGAAACTGGACGTCTGGG BCL2-IGH@ BOWTIE+STAR 18:63126317:-...

Hi, Glad to hear that BOWTIE+STAR might be correct. Indeed, I will try to fix this. Also indeed you are right, Ns are when BOWTIE+STAR is used. And indeed BOWTIE+SPOTLIGHT...

Thanks for the bug report! I will take a look! When you reconstructed the protein sequence did you use the gene annotation from Ensembl release 90 (which is used by...

ok. Thanks!