fcs
fcs copied to clipboard
ncbi
Foreign Contamination Screening caller scripts and documentation
Hello. Half of my FCS-GX runs still end in crashes, even after assigning FCS-GX more than 470 Gb memory in every run (which was suggested in issue #69). The crashes...
Hello. Below is a log from an FCS-GX run that crashed with the message `gzip: stdin: No data available`. What has happened here, and how to prevent this problem? ```...
Hello. This issue is a follow-up for issue #69. When running FCS-GX, the LSF logs always underreport how much memory FCS-GX uses. Below is an example of an LSF log...
Hello, I have been working on submitting a genome to NCBI, and along with many others have internal contamination by adaptors (as identified by FCS-adaptor). As recommended, I am trying...
*Describe the bug* I am running fcs-adaptor.sh v0.4.0 using Singularity on several genome assemblies generated using SPAdes v3.15.5. Nearly all of them run without error, but I consistently get a...
*Is this a feature request for FCS-adaptor or FCS-GX?* Yes *Describe the problem you'd like to be solved* At the moment, the output of FCS add a prefix to the...
Hello, We are running FCS on a set of genomes before submission to NCBI. We use the following command: ``` python3 fcs.py --image {fcs_img} screen genome --fasta {input.asm_fasta} --gx-db {params.GXDB_LOC}...
*Is this a feature request for FCS-adaptor or FCS-GX?* FCS-adaptor (I am using v0.4.0) *Describe the problem you'd like to be solved* Don't fail on sequences
*Is this a feature request for FCS-adaptor or FCS-GX?* This is a feature request for FCS-GX. *Describe the problem you'd like to be solved* After making `fcs.py` executable, running the...
Which manufacturers' sequencing adapters are included in the reference database of FCS-adaptor? Does it include BGI's sequencing adapters (BGISEQ/MGISEQ)? Forward filter: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA Reverse filter: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG
