fcs icon indicating copy to clipboard operation
fcs copied to clipboard

Published 20 hours ago • verified publisher icon ncbi

Which manufacturers' sequencing adapters are included in the reference database of FCS-adaptor?

Open maruiqi0710 opened this issue 9 months ago • 2 comments

Which manufacturers' sequencing adapters are included in the reference database of FCS-adaptor? Does it include BGI's sequencing adapters (BGISEQ/MGISEQ)? Forward filter: AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA Reverse filter: AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG

maruiqi0710 avatar Sep 22 '23 10:09 maruiqi0710