pyfastx
pyfastx copied to clipboard
lmdu
a python package for fast random access to sequences from plain and gzipped FASTA/Q files
Hello @lmdu, I am planning to use `pyfastx` within [Nextstrain's Augur](https://github.com/nextstrain/augur) to support a new data curation command and it would be really helpful to be able to support xz-compressed...
Nice package! Is there a way to add a parameter to select an output folder for the index file? Sometimes the user might not have writing permission to the source...
Hi, I am using angsd to produce fasta sequences, these are automatically gzipped fasta files. If I open the fasta file with R-Biostrings the sequence compositon looks like this: ```...
Hi, I found an error when I use pyfastx.Fastq to parsing the long read FASTQ file. The read.name untimely appearance in the end of read.seq string, such as 'GGCATTTTTCCGTTTGTCACTTCTTCTTCGCTATCCTGTT@390872df-5709-4012-8278-1f4969a328af ch=103...
We noticed that `pyfastx` cannot be built currently because it pins the `zlib` release `1.2.13`. This release's zip has been pulled from https://zlib.net/. I've updated the pinned version to `1.3`...
Hi and thanks a lot for this super-fast python library. We'd like to use this in our tools like Bakta and Platon. Maybe I've overlooked something, but we need a...
Thanks @lmdu for the great tool. I noticed I'm getting a segmentation fault when trying to call the `.composition` function on individual contigs. For comparison `.gc_content` works fine in this...
When loading e.g. the below gzipped fasta file: hgdownload.cse.ucsc.edu/goldenPath/dp3/bigZips/dp3.fa.gz I get: ```python fasta = pyfastx.Fasta('./data/genomes/dp3.fa.gz') RuntimeError: get seq count and length error The above exception was the direct cause of...
How to make a new Read object from string, so that I can call Read.antisense ? ``` fa = pyfastx.Fastx("x.fq") for name,seq,_ in fa: seqF = seq[:100] ``` I want...
