Ling Min Hao

In this pull request: - more unit tests are added to check for different cases of alternative splicing in the `compareTranscripts` function. - a more complete documentation of the `compareTranscripts`...

1) In this pull request, I added some unit tests for the writeBambuOutput() function. It tests whether: - the prefix is as expected - the output files go to the...

The unit test & documentation for the `compareTranscripts()` function is incomplete. The test should cover all possible scenarios when comparing two transcripts from alternative splicing events. The documentation should explain...

No novel transcripts meet the given threshold

1

If we run bambu with a given NDR threshold and there are no novel transcripts below the given threshold, an error will occur. 

Hi, is there any way to specify the number of cores for the single cell run so we can execute it faster like on a dataset with > 20 millions...

Flanking sequence match

3

Can I know when flames match flanking sequence `CTACACGACGCTCTTCCGATCT,` do they allow matching with an edit distance or it has to be exact match?

- fix the bug mentioned in GoekeLab/bambu-singlecell-spatial#14