Flanking sequence match

[lingminhao]

Can I know when flames match flanking sequence CTACACGACGCTCTTCCGATCT, do they allow matching with an edit distance or it has to be exact match?

[ChangqingW]

Allowing a maximum edit distance as specified for the <5.max edit distance> argument in match_cell_barcode. Both flanking sequence alignment and barcode matching allow up to <5.max edit distance>.

[lingminhao]

@ChangqingW , thanks for the reply ! Just for further confirmation, is max edit distance means max edit distance for both flanking sequence alignment and barcode matching or max edit distance for each ?

[ChangqingW]

I believe it is currently implemented as "for each"