FusionDirect.jl icon indicating copy to clipboard operation
FusionDirect.jl copied to clipboard

(No maintenance) Detect gene fusion directly from raw fastq files

Results 6 FusionDirect.jl issues
Sort by recently updated
recently updated
newest added

Hi, guys, I was using Julia 1.1.0-DEV.270(2018-09-17), and I successfully installed FusionDirect package. However, when I tried to use this package, it popped up the following error message. Can you...

Hello, is it possible to have a symbol such as "*" between two sequences merged together? Below is an example; AACAACGGGAAGAGGGCAAAGTGAAGCAGCCACAGGAAGAGGACTGGACG*CCCCAGACCCGGGCCTCCTGAGCTACACTGACAAGCTGTGTTCCCAGAAA Thanks.