FusionDirect.jl
FusionDirect.jl copied to clipboard
(No maintenance) Detect gene fusion directly from raw fastq files
Results
6
FusionDirect.jl issues
Sort by
recently updated
recently updated
newest added
Hi, guys, I was using Julia 1.1.0-DEV.270(2018-09-17), and I successfully installed FusionDirect package. However, when I tried to use this package, it popped up the following error message. Can you...
Hello, is it possible to have a symbol such as "*" between two sequences merged together? Below is an example; AACAACGGGAAGAGGGCAAAGTGAAGCAGCCACAGGAAGAGGACTGGACG*CCCCAGACCCGGGCCTCCTGAGCTACACTGACAAGCTGTGTTCCCAGAAA Thanks.
note REQUIRE is upped to julia 0.5. Ok?
Like FLT1/FLT3