yy549159265

By command `(dp)yuanshuai20@ZH404 bismark]$ samtools view SRR10498878_1_bismark_bt2_pe.bam | head -4` ``` SRR10498878.8_8_length=150 99 4 26375785 42 30M = 26375942 207 TTTATTAATTTATTAAAATTTTGAAATATT FKKKKKKKKKKKKKK

> A couple of things: > > * I suppose you did run the Bismark genome preparation first, then ran a trimming step, e.g. with Trim Galore (https://github.com/FelixKrueger/TrimGalore), followed by...

> A couple of things: > > * I suppose you did run the Bismark genome preparation first, then ran a trimming step, e.g. with Trim Galore (https://github.com/FelixKrueger/TrimGalore), followed by...

> A couple of things: > > * I suppose you did run the Bismark genome preparation first, then ran a trimming step, e.g. with Trim Galore (https://github.com/FelixKrueger/TrimGalore), followed by...

> erm, no? The all of the chromosomes are in the file. Thank you very much for your help！This tool will be better and better