bismark_methylation_extractor

[yy549159265]

I'm a newbie ，doing bismark_methylation_extractor, why does the cov file have zero lines

bismark_methylation_extractor -p
--parallel 16
--bedGraph --counts
--cytosine_report --report
--CX
--comprehensive
--buffer_size 10G
$i
--genome_folder /home/yuanshuai20/DP/Transcribe/process/gene_index/ina
-o /home/yuanshuai20/DP/Transcribe/process/result/

reference genome file Ensembl Oryza_indica.ASM465v1.dna.toplevel.fa

[yy549159265]

By command (dp)yuanshuai20@ZH404 bismark]$ samtools view SRR10498878_1_bismark_bt2_pe.bam | head -4

SRR10498878.8_8_length=150      99      4       26375785        42      30M     =       26375942        207  TTTATTAATTTATTAAAATTTTGAAATATT  FKKKKKKKKKKKKKK<KKKKKKKKKFFKKK  NM:i:8  MD:Z:0C1C1C0C4C8C0C7C1  XM:Z:h.h.hh....h........hx.......h.     XR:Z:CT XG:Z:CT
SRR10498878.8_8_length=150      147     4       26375942        42      50M     =       26375785        -207    TATGATTTTAATTTATTTGATAAGAATTTAAAAGATTAGATATTTTGTAT      FKAKKFKKFKKKKKAFFKFKKKKFAAAAFKKKKKKFKA7FKKAFFF7KAK      NM:i:11 MD:Z:0C5C4C0C0C3C2C14C7C0C4C0   XM:Z:h.....h....hhh...z..h..............h.......hx....h  XR:Z:GA XG:Z:CT
SRR10498878.10_10_length=150    83      9       16116016        42      69M     =       16115872        -213    TTCTATCTTTAACCATTTCTTTTATACAAATATAATTATTCAACAATTACTCAAATTTTTCAACATTTC   FFAKKFKAAAKKKKFKFKKKFFKAKFKKKF<,KKKKKFFKKKFKFKAKAKKKKFKKKKKKKKKKKKKKK   NM:i:11 MD:Z:4G6G13G2G2G5G7G2G4G0G7G6    XM:Z:....x......h.............h..x..h.....h.......x..h....xh.......x......      XR:Z:CT XG:Z:GA
SRR10498878.10_10_length=150    163     9       16115872        42      56M     =       16116016        213     TTAAACCATTTAAATTCAAACTTAATTCAATAACCATATCTTTCTATAAATTAAAA        KFKKKK7FKKFKKKKKKFKKKKKKKKKFFFKKKKA<KKKKKKKKFKKKKFFKKKKK        NM:i:3  MD:Z:12G16G24G1 XM:Z:............h................x........................h.    XR:Z:GA XG:Z:GA`

This is the bam file I generated

[FelixKrueger]

A couple of things:

• I suppose you did run the Bismark genome preparation first, then ran a trimming step, e.g. with Trim Galore (https://github.com/FelixKrueger/TrimGalore), followed by Bismark alignments - and all completed fine?

• When you say the coverage file has zero lines, can you go back through the logs to see if something failed, and why it failed? Did the methylation extraction run to completion? Did you get any error messages that the rice genome has thousands of small-ish scaffolds and contigs? I would probably suggest you re-run the bedGraph step using the option --scaffolds).

In your previous post I also saw: [W::bam_hdr_read] EOF marker is absent. The input is probably truncated: such an error certainly also has the potential to crash the whole process....

[yy549159265]

A couple of things:

• I suppose you did run the Bismark genome preparation first, then ran a trimming step, e.g. with Trim Galore (https://github.com/FelixKrueger/TrimGalore), followed by Bismark alignments - and all completed fine?
• When you say the coverage file has zero lines, can you go back through the logs to see if something failed, and why it failed? Did the methylation extraction run to completion? Did you get any error messages that the rice genome has thousands of small-ish scaffolds and contigs? I would probably suggest you re-run the bedGraph step using the option --scaffolds).

In your previous post I also saw: [W::bam_hdr_read] EOF marker is absent. The input is probably truncated: such an error certainly also has the potential to crash the whole process....

Thank you very much for your reply. Dear author, I found the relevant answers in the history question. I decided to try your answer before。 Use fastqc for quality control, fastp for filtering, bismark for genome comparison, and deduplicate_ Bismark de duplication

[yy549159265]

A couple of things:

• I suppose you did run the Bismark genome preparation first, then ran a trimming step, e.g. with Trim Galore (https://github.com/FelixKrueger/TrimGalore), followed by Bismark alignments - and all completed fine?
• When you say the coverage file has zero lines, can you go back through the logs to see if something failed, and why it failed? Did the methylation extraction run to completion? Did you get any error messages that the rice genome has thousands of small-ish scaffolds and contigs? I would probably suggest you re-run the bedGraph step using the option --scaffolds).

In your previous post I also saw: [W::bam_hdr_read] EOF marker is absent. The input is probably truncated: such an error certainly also has the potential to crash the whole process....

Attempt to use the command to successfully output the cov file，Thank you very much bismark2bedGraph --CX -o test.cov -scaffolds CpG_context_SRR10498878_1_bismark_bt2_pe.deduplicated.txt

[yy549159265]

A couple of things:

• I suppose you did run the Bismark genome preparation first, then ran a trimming step, e.g. with Trim Galore (https://github.com/FelixKrueger/TrimGalore), followed by Bismark alignments - and all completed fine?
• When you say the coverage file has zero lines, can you go back through the logs to see if something failed, and why it failed? Did the methylation extraction run to completion? Did you get any error messages that the rice genome has thousands of small-ish scaffolds and contigs? I would probably suggest you re-run the bedGraph step using the option --scaffolds).

In your previous post I also saw: [W::bam_hdr_read] EOF marker is absent. The input is probably truncated: such an error certainly also has the potential to crash the whole process....

Hello, the name of the first chromosome in the cov file is 1. Does this affect the subsequent differential expression analysis

[FelixKrueger]

erm, no? The all of the chromosomes are in the file.

[yy549159265]

erm, no? The all of the chromosomes are in the file.

Thank you very much for your help！This tool will be better and better