Whippet.jl icon indicating copy to clipboard operation
Whippet.jl copied to clipboard

Lightweight and Fast; RNA-seq quantification at the event-level

Results 47 Whippet.jl issues
Sort by recently updated
recently updated
newest added

Dear Team, I run Whippet on my paired-end, unstranded, polyA+ RNA-seq dataset. The dataset is of 75bp length (all reads in all samples have this length) and performed in triplicates...

Dear Tim, I would like to make an MA plot showing dPSI and gene/event expression relationships. In the PSI files there is a Total Reads column. Should I use the...

Hi, First I want to know the meaning of "Total Reads" in .psi.gz files. And what kind of analysis can we use this data to do? Second, I want to...

Hi, I have about 30 samples which I want to do a differential splicing analysis on. The instructions for including unannotated splice sites suggests that I first merge all my...

Is there a way to (easily) identify the novel events, or is it possibly to add a label to novel events in future updates?

Status: Accepted

Hi, How were the annotation files for refseq created / where were they taken from? The transcript reference sequence identifiers lack veresion numbers and I would like to re-create the...

Error trying to run psi quantification `ERROR: LoadError: BoundsError: attempt to access 35nt DNA Sequence: CGGGTGCTTTCTGCCCACCCCCTGCTCTTGCCAGC at index [31:36] Stacktrace: [1] checkbounds(::BioSequences.BioSequence{BioSequences.DNAAlphabet{2}}, ::UnitRange{Int64}) at /home/jordi/.julia/v0.6/BioSequences/src/bioseq/indexing.jl:15 [2] BioSequences.BioSequence(::BioSequences.BioSequence{BioSequences.DNAAlphabet{2}}, ::UnitRange{Int64}) at /home/jordi/.julia/v0.6/BioSequences/src/bioseq/constructors.jl:33...

Hi Tim @timbitz I have used Whippet successfully on a few different files and cell types. In my current experiment I have several comparisons to make, each one with the...

Addition of Dockerfile for version 0.11 Locally it works for me. The commands are called without the bin prefix as shown below: `julia whippet-index.jl --help` and not `julia bin/whippet-index.jl --help`...

Hi Do you have any Dockefile available for whippet? Thank you in advance Foivos