ice
ice copied to clipboard
Synthego ICE - Inference of CRISPR Editing software
I did not find a way to increase the maximum indel size in the site or as an option in the command line version. I am interested in deletions generally...
Hi Thanks for sharing this tool. After installation when running the example I get the following error: ``` $ synthego_ice --control ./ice/tests/test_data/good_example_control.ab1 --edited ./ice/tests/test_data/good_example_edited.ab1 --target AACCAGTTGCAGGCGCCCCA --out results/testing --verbose Synthego...
Hi, I am trying to extract the knockout score for a sample run as an individual sample. Can you please let me know which json file to parse? Thanks
Hi, Can you please point me to the GitHub link for ICE v3? Thanks
I get the error in the title. I dont see it listed exactly the same way in the websites troubleshooting guide. The wording is a little weird so Im wondering...
Hi there, we recently encountered a problem running ICE (v1.2.0). See the error below: ------- Traceback (most recent call last): File "/ice/ice/analysis.py", line 82, in single_sanger_analysis sa.analyze_sample() File "/ice/ice/classes/sanger_analysis.py", line...
Dear ICE devs, I just noticed `python ice_analysis_single.py --version` says 1.2.0. Just curious what's been changed since v1.1.0? Thanks, Pei
i got it working, can you share the part to make the graphics like you have in the web server from contrib.txt thanks
Putting this as a new feature request or question, as a lot of our users are asking for it. In knockin experiments scientists want to check the actual inserted sequence....
Hi there, we use ICE with docker install. It is very easy and fast to use, thanks! I am curious what exactly the error was if a sample failed analysis....