Nathan S. Watson-Haigh

Include input read filenames to log

1

I've run `ngmlr` on multiple files and sent the log info to file. Looking at the logs, it's not easy to determine which belongs to which since the output only...

Missing Indels

7

My own analysis of Illumina (`SRR11140750`, bottom track) and nanopore (`SRR11140751`, top track) data from the same swab sample shows your variant analysis doesn't include indels:  You probably should...

Derived_from not checked

1

TAIR10 GFF file (ftp://ftp.arabidopsis.org/home/tair/Genes/TAIR10_genome_release/TAIR10_gff3/TAIR10_GFF3_genes.gff) contains the attribute `Derived_from` which references ransposable element features not defined in the GFF file. I think that `gt gff3` should throw an error (perhaps only...

Make SNPCoverage track support different source data

2

I like that SNPCoverage tracks convey information about both coverage as well as the number of mismatches for any given position. However, rendering all this info directly from a BAM...

trackMetadata sources overridden in multiple json config files

1

JBrowse 1.16.3 My configuration files are split across multiple json files so that each contains all the relevant info for a given data set. These include `trackMetadata` such as: ```json...

Better Support for GFF3 Dbxref and Ontology_term attributes

6

As things are, the GFF3 attributes `Dbxref` and `Ontology_term` are displayed in plain text in the "view details" window:  While it is possible to use `fmtDetailValue_Dbxref` and `fmtDetailValue_Ontology_term` with...

Bug: Negating TAB characters

1

I want to match all non-tab characters at the start, or end, of a string. For example, I have the following tab-delimited string where the two columns also contain a...

The following command/regex: ``` $ paste - - - - < in.fastq | agrep --colour --show-position --show-cost -e ((TGGAATTCTCGGGTGC){#5}|(TGGAATTCTCGGGTG){#5}|(TGGAATTCTCGGGT){#4}|(TGGAATTCTCGGG){#4}|(TGGAATTCTCGG){#3}|(TGGAATTCTCG){#3}|(TGGAATTCTC){#2})\t ``` Results in this output: ``` 0:64-78:@HWI-ST212_0173:2:1101:1723:1950#GCCAAT/1 TTTTATTATGATCCATTTCGCG^[[01;31mTGGAATTCTCGGG ^[[00m+HWI-ST212_0173:2:1101:1723:1950#GCCAAT/1 gggggggdggeggeegggggggeggddggdgdeeg 0:67-78:@HWI-ST212_0173:2:1101:2933:1959#GCCAAT/1...

Segmentation Fault

1

I'm loving tre-agrep for matching DNA sequence strings. However, I keep getting segmentation faults when my regular expression grows: ``` shell $ tre-agrep -V tre-agrep (TRE agrep) 0.8.0 Copyright (c)...

In order to build tre on Ubuntu 12.04, you also need to install autopoint, which is currently not documented in README.darcs. I ran the following to install the prerequisites before...