Marcel Martin

Cutadapt doesn’t have any special treatment for binned quality scores. I don’t know what to do about it to be honest, did you mean anything in particular? I’d guess the...

To clarify: - Cutadapt does not use quality scores when finding adapters. - The only Cutadapt options that use quality values are, as far as I am aware, the following...

Exactly, I don’t think binned quality values matter for Cutadapt. Maybe it’s worth documenting this – please leave the issue open for now and I’ll see whether I can add...

Hi, not sure if this is still relevant. > ``` > cutadapt -e 0 --no-indels --pair-filter=both \ > -g file:adapterA_fwd.fasta -G file:adapterA_fwd.fasta \ > -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT \ >...

Is this paired-end or single-end data? Don’t use `--times=7` – this is only meant to be used when you want to remove up to 7 adapters from each read. I...

> This is paired-end data. Then please also have a look here: https://cutadapt.readthedocs.io/en/stable/recipes.html#trimming-amplicon-primers-from-paired-end-reads This is how to trim paired-end data "in spirit", but you need to adjust it to deal...

Hi, > For some reads though I still saw the primers existing: Since you used `--discard-untrimmed`, I’m very sure that a primer was removed from those reads. These examples are...

> My question is the following: Would it be possible to perform demultiplexing step by cutadapt by including both adapter and barcode as part of a single "ADAPTER" in a...

Hm, I think I’d try this as well, maybe decreasing the allowed error rate a little bit if the combined length is getting large. What do you mean with "messes...

This is intentional (or you could say a a known limitation). See https://cutadapt.readthedocs.io/en/stable/guide.html#demultiplexing: > Paired-end demultiplexing always uses the adapter matches of the **first** read to decide where a read...