Luan Nguyen

If I align this sequence to GRCh37 (specifically to Homo_sapiens.GRCh37.GATK.illumina.fasta): ``` >ASSEMBLY_1:4356585:-1|FULL_SEQ GCATCCACAGGATCATCACTAGGAGGATTTTTCTTTTTCCCCTTCCTCTCTCTCCTTCCTTCTCACCACGCATCTGTCCATCCATTCATCCAACCATTCATCCATCCATCCATCCATCCATCCATTCATCCATCCATCCATCCATCCATCCG ``` I get a primary alignment (1st row) and a supplementary alignment (2nd row): ``` ASSEMBLY_1:4356585:-1|FULL_SEQ 0...

Add hmftools-gene-utils

1

Describe your pull request here ---- Please read the [guidelines for Bioconda recipes](https://bioconda.github.io/contributor/guidelines.html) before opening a pull request (PR). ### General instructions * If this PR adds or updates a...

Update bwa-mem2 with changes since v2.2.1

3

Hi there, Would it be possible to update the [bwa-mem2 recipe](https://github.com/bioconda/bioconda-recipes/tree/master/recipes/bwa-mem2) to include the changes since v2.2.1 up until the current commit [7aa5ff6](https://github.com/bwa-mem2/bwa-mem2/commit/7aa5ff6c3330490e5629ab9b7327683d2dce02d6)? Ideally, there would be a v2.2.2 release...

Hi there, I was wondering if it's possible to make tests that only check if the commands in the .command.sh file are correct (without processes actually running)? I imagine this...