parasail
parasail copied to clipboard
jeffdaily
Pairwise Sequence Alignment Library
What would be the command line parameters for `parasail_aligner` for doing local pairwise alignment (without gaps within the sequences) of two DNA sequences For example, `1.fa` is like this ```...
I haven't been able to get a simple DNA search to produce a result. I am sure I am doing something silly. I couldn't find a simple invocation example for...
Hi, jeffdaily, thanks for your great work! Let's start with an exmple. When I do a global alignment for these two sequences: ``` seq1: CAGGACGAGGAGCAGAGGACAAGGAGGAT seq2: CAGGACGAGGAGCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGGACAAGGAGGAT ``` The traceback...
When there are several different alignments with the best score, how does parasail choose which alignment/traceback to return? Can it enumerate all best-scoring alignments, in the manner of BioPython's Bio.Align.PairwiseAligner?...
Example query `GAAT` and database/target `AGAATA`. The returned cigar via `parasail_result_get_cigar` is `beg_query=0`, `beg_ref=0`. The ends are fine (from the result) `end_query=3`, and `end_ref=4`. I would expect the following alignment:...
In `result`, is there a way to calculate the similarity percentage of alignment? Is 1916 an acceptable score? thanks in advance!
Unless I'm mistaken, I believe `i+=1` should be `i+=2` in two places: https://github.com/jeffdaily/parasail/blob/600fb26151ff19899ee39a214972dcf2b9b11ed7/src/traceback.c#L43-L50 https://github.com/jeffdaily/parasail/blob/600fb26151ff19899ee39a214972dcf2b9b11ed7/src/cigar_template.c#L172-L179 As is, `alphabet_aliases = "AaBb"` would treat `a` and `B` as equivalent. My understanding of the...
When using `parasail_sg_[datatype]` to obtain the full alignment score and the alignment end positions, I expect `parasail_sg_qb_db_[samedatatype]` to produce the same alignment score when aligning the prefix sequences given by...
Hello, I'd like to vendor parasail as part of a library, which doesn't need any of the executables (`test_*` and the aligner), just the library component. Is there a way...
I want `-a sw_scan_16 -e 1 -o 11`, however, `-O EMOBOSS` also not work when `-a sw_stats_striped_16` (defulat setting) ``` [lihuilin@login01 bin]$ ls myseqs.fasta mytrace parasail1.csv parasail_aligner parasail.csv parasail_stats tb...