parasail icon indicating copy to clipboard operation
parasail copied to clipboard

Question only - pairwise local alignment without gaps

Open ndaniel opened this issue 7 years ago • 1 comments

What would be the command line parameters for parasail_aligner for doing local pairwise alignment (without gaps within the sequences) of two DNA sequences

For example, 1.fa is like this

>1
GCCCCAGTAGGCAACACGCTGGCTGGCTGGCTGTCCGGGC

and 2.fa is like this:

>2
GCCCCAGTAGGCAACACGCTGGCTGGCTGGCTGTCCGGGC

and I want to get them aligned like this:

ACGGTGACCAGGGTTCCCTGGCCCCAGTAGGCAACACGCTGG------------------
--------------------GCCCCAGTAGGCAACACGCTGGCTGGCTGGCTGTCCGGGC

ndaniel avatar Dec 14 '16 10:12 ndaniel