bioperl-live
bioperl-live copied to clipboard
Core BioPerl 1.x code
I am trying to install Bio::Perl on Ubuntu using this command: `sudo cpan install Bio::Perl` The installation seems to fail in both Bio::DB::GenBank and Bio::DB::GenPept due to Taxonomy.t Here are...
* the window count was off for cases where the sequence length aligned with the window size * i also bumped up the max buffer size
When writing GFF, the same frame is assigned to every range in a multi-exon gene rather than correctly assigning 0,1 or 2 to specify the frame [ Twitter note including...
I have created some changes on top the PR at #223 that would allow the use of a specific branch for running network tests on a regular basis. The changes...
for zenodo it might be good to make a citation link for future releases. needs to be more than just the old paper but all the new contributors? https://github.com/bioperl/bioperl-live/new/master?filename=CITATION.cff https://citation-file-format.github.io/...
Hi, I am trying to install Bioperl v1.7.2 in my Ubuntu system. I am using following command but I am uncertain to use a particular version of Bioperl for the...
When I use Bio:DB:Taxonomy I get the following error: MSG: Can't query website: 500 Can't connect to eutils.ncbi.nlm.nih.gov:443 STACK: Error::throw STACK: Bio::Root::Root::throw /usr/share/perl5/Bio/Root/Root.pm:449 STACK: Bio::DB::Taxonomy::entrez::_run_query /usr/share/perl5/Bio/DB/Taxonomy/entrez.pm:658 STACK: Bio::DB::Taxonomy::entrez::get_taxon /usr/share/perl5/Bio/DB/Taxonomy/entrez.pm:267 NCBIs...
Hello, I have trying for several days to install Bio::DB::Fasta module on my conda enviornment. I t should be straightforward to install but I keep getting this error message `Can't...
On some of my smoker systems t/SeqFeature/Generic.t in BioPerl-1.7.8 fails like this: ``` # Failed test at t/SeqFeature/Generic.t line 222. # got: 'ATGGCTCGCTTCGTGGTGGTAGCCCTGCTCGCGCTACTCTCTCTGTCTGGCCTGGAGGCTATCCAGCNNN' # expected: 'ATGGCTCGCTTCGTGGTGGTAGCCCTGCTCGCGCTACTCTCTCTGTCTGGCCTGGAGGCTATCCAGCATG' # Failed test at...
Please note that this repository is participating in a reserach study called "[Sustainability in Open Source Projects](https://sustainable-open-science-and-software.github.io/)". Data will be gathered about this repository for approximately the next 12 months,...