LuShuYangMing

I tried this example, but boxplot are all shift to left. `dat % hc_chart(type = "boxplot") %>% hc_add_series_list(dat)%>%hc_colors(c("green","red"))%>%hc_add_theme(hc_theme_ggplot2())%>% hc_xAxis(list(categories = c('Apples', 'Oranges', 'Pears'),opposite='true',min=0,labels=list(style=list(color='#FF0000'))), list(categories = c('2014', '2015', '2014', '2015', '2014',...

How to use Pre-alignment processing perl script?

1

Hi I have downloaded scripts from [http://www.bcgsc.ca/platform/bioinfo/software/adapter-trimming-for-small-rna-sequencing](url). When I run this script by using `perl adapter_trim.pl -a TACTCTCGTATGCCGTCTTCTG SRRxxxx.fastq.gz` command, the program took a long time to run without stopping....

Hello,   Can I create highchart output like wordcloud2 output style (below image)? Because image created from highchart was loose but can create high resolution pdf, while R package 'wordcloud2' was...