hap.py

hap.py copied to clipboard

Usage with different VCF callers

1

I have been trying to run hap.py in order to benchmark using HG002. I have an ensemble of 8 different callers (breakdancer, cnvkit, cnvnator, delly, gridss, lumpy, manta, and wham)...

stanleyrc

FP in phased variant overlapping non-phased variant

3

Hello, It seems like hap.py does not properly handle phased variants that overlap with non-phased variants. Here is an example: ``` chr20 55234351 . A T 500 PASS AC=1;AF=0.5;AN=2;DA=39;DP=78;GM=1;MC=0;MF=0;MQ10=1;MQ20=1;MQ30=1;MQ40=1;MQ50=1;SC=TGTATGTGTAAATATATATAT;set=variant2-variant3 GT:GQ:PS:UG:UQ...

arangrhie

Please find below my YAML file content. I am getting the error while executing docker-compose up -d though I had to change the permission via 1000. version : '3' services:...

puneetgaurrr

Hi, I don't understand how the ROC Precision recall curve can be made with other metrics. As I understand the --roc switch to feature on must be in the query...

KewinOgink

I got this error while running hap.py on the vcfs provided by GROM tool. Both Truth vcf and reference fasta have chromosome 1 and are taken from GIAB. Can you...

aditya-sarkar441

hap.py failing with errors

1

I don't understand why this is breaking and how to fix it, please help. I use this in a conda environment ``` [W] overlapping records at chr1:37070742 for sample 0...

m-lazarova

Hello! The last version in dockerhub is 0.3.9 : https://hub.docker.com/r/pkrusche/hap.py/tags?page=1&ordering=last_updated The latest 0.3.14 : here is https://github.com/Illumina/hap.py/releases/tag/v0.3.14 Would it be possible to update the image there? Cheers! --Maxime

valleema

Post installation validation test fails

6

I installed the latest hap.py successfully. But the built-in post-installation testing fails during Faulty variant test. Here's the error output: Test for reading and detecting problematic records: Hap.py v0.3.10-8-gdac84d9 from...

adigorla

pre.py for normalization errors

3

Good Afternoon, I am attempting to use pre.py to normalize VCFs. However, I am getting the following errors with this command. I have tried this on a few different VCFs...

christinafliege

Hi all, This may be a silly question, but could not find the reasoning here or in the bench marking paper. I've run hap.py with high confidence regions, using: singularity...

sr-bentley