Catarina Loureiro

WIP First draft logic to: - generate input files required for sourmash - run sourmash with the branchwater plugin in the cmdline - perform network/clustering with a UnionFind algo and...

add adapters to known adapters file

1

Hi all, I just received Illumina NovaSeq PE sequencing data, and according to the sequencing company, the following adapters were used: ``` Sequences of adapter P5 adapter： P5→P7’(5’→3’) AATGATACGGCGACCACCGAGATCTACAC[i5*]ACACTCTTTCCCTACACGACGCTCTTCCGATCT P7...

accessing noabund param in sourmash python API

5

Hi sourmash developers! I would like to run sourmash from within a python application, more specifically sourmash sketch protein with parameters (k=10, scaled=200, noabund). I can see from your documentation...