zyh4482

BTW, I'm using VEP 104. It works well in other pipeline or with other files. I suppose re-installation of VEP is not a solution in my case. I also tried...

After some debug, I found a solution. At line 460: ` $vep_cmd .= " --no_stats --buffer_size $buffer_size --sift b --ccds";` The parameter ` --no_stats` causes this bug. Currently, VEP team...

@eibol1 It's been nearly one year, scripts or information may be updated. So I'm not sure if the answer still works. line 460 of the script `vcf2maf.pl` has the argument...

My vcf have full header. But after split-vep splitting csq columns, all the header disappear. Part of the first line of the output looks like: `chr1 36178715 GGCCGAGGCCCGGGCGGAGCGGGAGGCGGAGGCCCGGAGGCGGGAG G -...

Sorry for the confusion. I understand now. The "header" I mentioned above should refer to the header of tab-delimited table rather than vcf. For instance, I would like to add...

Is there a solution?

This issue happens on my side with following message: `-- Could NOT find CUDA (missing: CUDA_INCLUDE_DIRS) (found version "12.6") ` When compiling with cmake, use the following command as above...

May I ask what if it is a pair-end fastq? Would you mind providing an example for this case? Because my data are huge and collected from various sources, it...

I re-ran the test and checked the task manager this time. I found that after calculating exon skip events, spladder did not proceed on the next task anymore. It just...

By adding -v parameter, the test module is working in my case.