zslastman

Issue with Primer class instantiation

4

Trying to run this code from the docs: ``` from pydna.dseqrecord import Dseqrecord from pydna.readers import read from pydna.amplify import pcr from pydna.primer import Primer template = Dseqrecord("tacactcaccgtctatcattatctactatcgactgtatcatctgatagcac") from Bio.SeqRecord...

Ribostan

63

Update the following URL to point to the GitHub repository of the package you wish to submit to _Bioconductor_ - Repository: https://github.com/zslastman/Ribostan Confirm the following by editing each check box...

GGvis doesn't work with knitr's 'spin' function

1

Sorry if this is an issue for the knitr guys rather than you... This works fine and results in a plot on the html report outputted by running spin() on...

Hey guys - looks like the manual has the wrong default for the disp diff option: Text in the manual: ``` OPTIONAL: -d DISPDIFF Allow different dispersions for Ribo-seq and...

Hi guys - to double check some of my own work, I've been trying to compare it to scikit-ribo's estimates of predicted protein abundance (PA). If I read the paper...