telseq
telseq copied to clipboard
zd1
A software for calculating telomere length
Hi, The human reference genome has been improved these years and the latest one would be hg38 or GRCh38. Therefore, we decided to generate the input BAM file aligned with...
Compilation aborts and I get the following error when trying to compile TelSeq with the current version (2.5.1) of bamtools: ``` g++ -Wall -Wextra -Wno-unknown-pragmas -g -O0 -std=c++11 -Wl,-rpath,/data/_stephan/bamtools-2.5.1/lib -L/data/_stephan/bamtools-2.5.1/lib...
Hi, Recently I used TelSeq to estimate telomere length from WGS sequencing data (NovaSeq), with k = 7 and r = 151. The returned length falls in the range of...
Built image by downloading tagged version v0.0.2 ``` Program: TelSeq Version: 0.0.1 ```
Hello Zhihao, Thanks for designing this useful tool! I was wondering if there is a simple way to adapt it for cram input. It looks like bamtools doesn't support cram...
Hi, I am applying Telseq to WGS by DNBseq, MGI. All the results were roughly 3-5x shorter than the results by Illumina (Hiseq X, Novaseq 6000). Could anyone advise me...
Hi, unless I'm wrong, supplementary and seconday alignments are not ignored in your code. https://github.com/zd1/telseq/blob/master/src/Telseq/telseq.cpp#L275 shouldn't you remove them ? Furthermore, speed could be improved by using _references_ instead of...
Hi, Thank you for this helpful tool. I am running into a problem while I was trying to use a file containing list of paths as input. Every BAM file...
Thanks for this program. However, yeast has different telomere repeats so i ran it with the commandline telseq -z ACTTCTTGGTGTACGGATGTCTA -k 3 domenico.bam > test_sc ACTTCTTGGTGTACGGATGTCTA being the telomere repeats...
Hi! I have several read groups in my bam files. By default, it gives me LENGTH_ESTIMATE by each read group. When I use -m flag, which is supposed to give...
