Shifu Chen
Shifu Chen
I have got response from BGI team, they will send me the adapter list in a couple of days. I will update then and release a new fastp version.
Hi, I just got the sequences from MGI. I will update the built-in adapter sequences.
I just add MGI/BGI adapter sequences to the known adapters: knownAdapters["AAGTCGGAGGCCAAGCGGTCTTAGGAAGACAA"] = ">MGI/BGI adapter (forward)"; knownAdapters["AAGTCGGATCGTAGCCATGTCGTTCTGTGAGCCAAGGAGTTG"] = ">MGI/BGI adapter (reverse)"; Could you please try the latest build, or use the...
Since your data is paired-end, fastp can trim the adapters without adapter sequence provided. So it already worked before.
Guys, I will take this issue as first priority, and will fix it asap. Can you show me some polyA FASTQ records that are trimmed correctly by other tools, but...
Can you share some data here? I can hardly reproduce this issue with my own RNA-seq data. I suspect that this issue only happens when the template length is usually...
@downingtim @KatharineME @daonslog can you share some polyA reads that cannot be trimmed by fastp? Once I can reproduce it, I will fix it very soon.
I will take a look soon
Seems that your FASTQ is weird, can you please upload it here and I can have a try.
> Thank you for looking into this. For more context, this isn't the only pair of fastqs where I had the issue. Other fastqs failed in the same way, always...