rickbeeloo

Confused about + and - stranded nodes in GFA

5

Let's use this very simple FASTA: ``` >seq1 ATATGTCGCTGATCGACTGAAATAGCATCGACTAGCTATCGAT >seq2 ATATGTCGCTGATCGACTGAATAGTGAAATAGCATCGACTAGC >seq3 ATATGTCGCTGATCGACTTTTTTTTGAAATAGCATCGACTAGC ``` Then we construct the graph: `./twopaco -k 15 -f 16 test.fa -o graph` and convert it...

Memory leak when creating a lot of trees

1

I also posted this issue [here](https://github.com/databio/AIList/issues/16) as I'm not sure which of the two is maintained. **Simple example and look at `top/htop`** Take this simple example where we create a...

Hey Harry! I noticed that GPT will provide the full name of foods, for example take this input: "Sample from Samso Cheese" (Apparently[ a cheese from Denmark](https://en.wikipedia.org/wiki/Sams%C3%B8_cheese)). It will extract...

Advice on setting for short query in long reference search

5

Hey @Daniel-Liu-c0deb0t! I have a bunch of sequences (most 20nts, few 27nts) which I want to find in a lot (millions) of longer sequences. Initially I use a k-mer index,...

Hey Shelby, thanks for wrapping this all in a package! I'm often working with multiple choice questions. From previous experiments with a variety of LLMs I noticed that it's much...

I was a bit confused by: https://github.com/ShelbyJenkins/llm_client/blob/ed1c68a501a561548530dabd6019c2c561619328/src/llm_backends/llama_cpp/mod.rs#L27 As that path does not exist in the repo, so maybe adding ` git clone https://github.com/ggerganov/llama.cpp` in the README clarifies that. (Unrelated, cool...

Using strobemers bidirectionally to minimize effect of low hash bias + read border cases

1

Hey @ksahlin! Background First of all, it was fun to look at something other than "just" k-mers ;) nice idea! I was looking at the strobemers papers/code and in the...

Including `taln` column in output segfaults

2

When running: ```bash mmseqs easy-search q.fasta t.fasta mmseqs_tmp mmseqs_results --format-output "query,target,pident,alnlen,mismatch,gapopen,qstart,qend,tstart,tend,evalue,bits,qcov,tcov,qlen,qaln" --threads 60 --search-type 3 ``` it works fine, but adding `taln` to the output column breaks it: ```bash mmseqs...