Jonathan Manning

@nsheff and yes- those were two sections from the same config

@nsheff the issue with fasta_txome is that I'm going to have a lot of them (Ensembl versions, biotype sets etc), so if I can only have one of those per...

Here's an illustration of three fasta type assets (1 genome, 2 cDNA) under one genome identifier: ``` > tail $(refgenie seek pristionchus_fissidentatus--Pristionchus_fissidentatus_genome/fasta:genome) CCAAAAATATTAATACTAAA >scaffold54591 length=200 AAAAAAAATGGAGTAATAGGAATCCTAGGGTAGCTGGTAGCTAATTGAATTTTAATTATT GATTGTGAGTGTTTTTCTATTCTTTTGTGAGGGGAATTCTAAATGCGTAACGCATGGTTA CTTCCTGACAATGATATTATTGCAAATGGGCGAAATTCGAAAATTATGGAAGAATCGGAA AGCGGAAGCATTCAACATGT >scaffold56872...

@nsheff aha gotcha- thanks for clarifying fasta_txome, I'll try that now.

@stolarczyk yep, I did, but as things worked anyway I wasn't over-worried. If this really is naughty then things should probably exit at that point.

Using fasta_txome seems to be helping. I'm still getting a lot of the errors as reported in https://github.com/refgenie/refgenie/issues/253, but the config file seems to be maintaining consistency.

As per ^^^, we appear to be suffering from this still with 0.74.3, in our CI (which I think we mostly borrowed from you guys). Specifically, see https://github.com/ebi-gene-expression-group/container-galaxy-sc-tertiary/runs/2297130549

> You might need to invalidate the cache, by changing changing the galaxy release or the python version, or updating to match https://github.com/galaxyproject/tools-iuc/blob/master/.github/workflows/pr.yaml Did try invalidating the cache without any...

@BiocondaBot please add label

Thanks @dpryan79 !