mag icon indicating copy to clipboard operation
mag copied to clipboard
verified publisher icon nf-core

Add pydamage results to binqc table

Open jfy133 opened this issue 6 months ago • 9 comments

See code TODOs

To close https://github.com/nf-core/mag/issues/833

PR checklist

  • [ ] This comment contains a description of changes (with reason).
  • [ ] If you've fixed a bug or added code that should be tested, add tests!
  • [ ] If you've added a new tool - have you followed the pipeline conventions in the contribution docs
  • [ ] If necessary, also make a PR on the nf-core/mag branch on the nf-core/test-datasets repository.
  • [ ] Make sure your code lints (nf-core pipelines lint).
  • [ ] Ensure the test suite passes (nextflow run . -profile test,docker --outdir <OUTDIR>).
  • [ ] Check for unexpected warnings in debug mode (nextflow run . -profile debug,test,docker --outdir <OUTDIR>).
  • [ ] Usage Documentation in docs/usage.md is updated.
  • [ ] Output Documentation in docs/output.md is updated.
  • [ ] CHANGELOG.md is updated.
  • [ ] README.md is updated (including new tool citations and authors/contributors).

jfy133 avatar Jun 22 '25 05:06 jfy133

nf-core pipelines lint overall result: Passed :white_check_mark: :warning:

Posted for pipeline commit db7f618

+| ✅ 384 tests passed       |+
#| ❔   1 tests were ignored |#
!| ❗   6 tests had warnings |!

:heavy_exclamation_mark: Test warnings:

  • nextflow_config - Config manifest.version should end in dev: 5.3.0
  • pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
  • pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline
  • pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
  • pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
  • pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!

:grey_question: Tests ignored:

  • files_unchanged - File ignored due to lint config: .github/PULL_REQUEST_TEMPLATE.md

:white_check_mark: Tests passed:

  • files_exist - File found: .gitattributes
  • files_exist - File found: .gitignore
  • files_exist - File found: .nf-core.yml
  • files_exist - File found: .prettierignore
  • files_exist - File found: .prettierrc.yml
  • files_exist - File found: CHANGELOG.md
  • files_exist - File found: CITATIONS.md
  • files_exist - File found: CODE_OF_CONDUCT.md
  • files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
  • files_exist - File found: nextflow_schema.json
  • files_exist - File found: nextflow.config
  • files_exist - File found: README.md
  • files_exist - File found: .github/.dockstore.yml
  • files_exist - File found: .github/CONTRIBUTING.md
  • files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
  • files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
  • files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
  • files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
  • files_exist - File found: .github/workflows/branch.yml
  • files_exist - File found: .github/workflows/nf-test.yml
  • files_exist - File found: .github/actions/get-shards/action.yml
  • files_exist - File found: .github/actions/nf-test/action.yml
  • files_exist - File found: .github/workflows/linting_comment.yml
  • files_exist - File found: .github/workflows/linting.yml
  • files_exist - File found: assets/email_template.html
  • files_exist - File found: assets/email_template.txt
  • files_exist - File found: assets/sendmail_template.txt
  • files_exist - File found: assets/nf-core-mag_logo_light.png
  • files_exist - File found: conf/modules.config
  • files_exist - File found: conf/test.config
  • files_exist - File found: conf/test_full.config
  • files_exist - File found: docs/images/nf-core-mag_logo_light.png
  • files_exist - File found: docs/images/nf-core-mag_logo_dark.png
  • files_exist - File found: docs/output.md
  • files_exist - File found: docs/README.md
  • files_exist - File found: docs/README.md
  • files_exist - File found: docs/usage.md
  • files_exist - File found: nf-test.config
  • files_exist - File found: tests/default.nf.test
  • files_exist - File found: main.nf
  • files_exist - File found: assets/multiqc_config.yml
  • files_exist - File found: conf/base.config
  • files_exist - File found: conf/igenomes.config
  • files_exist - File found: conf/igenomes_ignored.config
  • files_exist - File found: .github/workflows/awstest.yml
  • files_exist - File found: .github/workflows/awsfulltest.yml
  • files_exist - File found: modules.json
  • files_exist - File found: ro-crate-metadata.json
  • files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
  • files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
  • files_exist - File not found check: .github/workflows/push_dockerhub.yml
  • files_exist - File not found check: .markdownlint.yml
  • files_exist - File not found check: .nf-core.yaml
  • files_exist - File not found check: .yamllint.yml
  • files_exist - File not found check: bin/markdown_to_html.r
  • files_exist - File not found check: conf/aws.config
  • files_exist - File not found check: docs/images/nf-core-mag_logo.png
  • files_exist - File not found check: lib/Checks.groovy
  • files_exist - File not found check: lib/Completion.groovy
  • files_exist - File not found check: lib/NfcoreTemplate.groovy
  • files_exist - File not found check: lib/Utils.groovy
  • files_exist - File not found check: lib/Workflow.groovy
  • files_exist - File not found check: lib/WorkflowMain.groovy
  • files_exist - File not found check: lib/WorkflowMag.groovy
  • files_exist - File not found check: parameters.settings.json
  • files_exist - File not found check: pipeline_template.yml
  • files_exist - File not found check: Singularity
  • files_exist - File not found check: lib/nfcore_external_java_deps.jar
  • files_exist - File not found check: .travis.yml
  • nextflow_config - Found nf-schema plugin
  • nextflow_config - Config variable found: manifest.name
  • nextflow_config - Config variable found: manifest.nextflowVersion
  • nextflow_config - Config variable found: manifest.description
  • nextflow_config - Config variable found: manifest.version
  • nextflow_config - Config variable found: manifest.homePage
  • nextflow_config - Config variable found: timeline.enabled
  • nextflow_config - Config variable found: trace.enabled
  • nextflow_config - Config variable found: report.enabled
  • nextflow_config - Config variable found: dag.enabled
  • nextflow_config - Config variable found: process.cpus
  • nextflow_config - Config variable found: process.memory
  • nextflow_config - Config variable found: process.time
  • nextflow_config - Config variable found: params.outdir
  • nextflow_config - Config variable found: params.input
  • nextflow_config - Config variable found: manifest.mainScript
  • nextflow_config - Config variable found: timeline.file
  • nextflow_config - Config variable found: trace.file
  • nextflow_config - Config variable found: report.file
  • nextflow_config - Config variable found: dag.file
  • nextflow_config - Config variable (correctly) not found: params.nf_required_version
  • nextflow_config - Config variable (correctly) not found: params.container
  • nextflow_config - Config variable (correctly) not found: params.singleEnd
  • nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
  • nextflow_config - Config variable (correctly) not found: params.name
  • nextflow_config - Config variable (correctly) not found: params.enable_conda
  • nextflow_config - Config variable (correctly) not found: params.max_cpus
  • nextflow_config - Config variable (correctly) not found: params.max_memory
  • nextflow_config - Config variable (correctly) not found: params.max_time
  • nextflow_config - Config variable (correctly) not found: params.validationFailUnrecognisedParams
  • nextflow_config - Config variable (correctly) not found: params.validationLenientMode
  • nextflow_config - Config variable (correctly) not found: params.validationSchemaIgnoreParams
  • nextflow_config - Config variable (correctly) not found: params.validationShowHiddenParams
  • nextflow_config - Config variable (correctly) not found: validation.failUnrecognisedParams
  • nextflow_config - Config variable (correctly) not found: validation.failUnrecognisedHeaders
  • nextflow_config - Config timeline.enabled had correct value: true
  • nextflow_config - Config report.enabled had correct value: true
  • nextflow_config - Config trace.enabled had correct value: true
  • nextflow_config - Config dag.enabled had correct value: true
  • nextflow_config - Config manifest.name began with nf-core/
  • nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
  • nextflow_config - Config dag.file ended with .html
  • nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
  • nextflow_config - Config params.custom_config_version is set to master
  • nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
  • nextflow_config - Lines for loading custom profiles found
  • nextflow_config - nextflow.config contains configuration profile test
  • nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
  • nextflow_config - Config default value correct: params.custom_config_version= master
  • nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
  • nextflow_config - Config default value correct: params.publish_dir_mode= copy
  • nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
  • nextflow_config - Config default value correct: params.validate_params= true
  • nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
  • nextflow_config - Config default value correct: params.spades_fix_cpus= -1
  • nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
  • nextflow_config - Config default value correct: params.metabat_rng_seed= 1
  • nextflow_config - Config default value correct: params.clip_tool= fastp
  • nextflow_config - Config default value correct: params.reads_minlength= 15
  • nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
  • nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
  • nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
  • nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
  • nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
  • nextflow_config - Config default value correct: params.bbnorm_target= 100
  • nextflow_config - Config default value correct: params.bbnorm_min= 5
  • nextflow_config - Config default value correct: params.longreads_min_length= 1000
  • nextflow_config - Config default value correct: params.longreads_keep_percent= 90
  • nextflow_config - Config default value correct: params.longreads_length_weight= 10
  • nextflow_config - Config default value correct: params.longread_adaptertrimming_tool= porechop_abi
  • nextflow_config - Config default value correct: params.longread_filtering_tool= filtlong
  • nextflow_config - Config default value correct: params.gtdb_db= https://data.gtdb.aau.ecogenomic.org/releases/release226/226.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r226_data.tar.gz
  • nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
  • nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
  • nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
  • nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
  • nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1
  • nextflow_config - Config default value correct: params.spades_downstreaminput= scaffolds
  • nextflow_config - Config default value correct: params.genomad_min_score= 0.7
  • nextflow_config - Config default value correct: params.genomad_splits= 1
  • nextflow_config - Config default value correct: params.binning_map_mode= group
  • nextflow_config - Config default value correct: params.bin_metabinner_scale= large
  • nextflow_config - Config default value correct: params.semibin_rng_seed= 1
  • nextflow_config - Config default value correct: params.semibin_environment= global
  • nextflow_config - Config default value correct: params.min_contig_size= 1500
  • nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
  • nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
  • nextflow_config - Config default value correct: params.bin_min_size= 0
  • nextflow_config - Config default value correct: params.bin_concoct_chunksize= 10000
  • nextflow_config - Config default value correct: params.bin_concoct_overlap= 0
  • nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
  • nextflow_config - Config default value correct: params.tiara_min_length= 3000
  • nextflow_config - Config default value correct: params.busco_db_lineage= auto
  • nextflow_config - Config default value correct: params.checkm_download_url= https://zenodo.org/records/7401545/files/checkm_data_2015_01_16.tar.gz
  • nextflow_config - Config default value correct: params.checkm2_db_version= 14897628
  • nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
  • nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
  • nextflow_config - Config default value correct: params.gunc_database_type= progenomes
  • nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
  • nextflow_config - Config default value correct: params.freebayes_ploidy= 1
  • nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
  • nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
  • nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
  • nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
  • nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
  • nf_test_content - 'tests/test_single_end.nf.test' contains outdir parameter
  • nf_test_content - 'tests/test_single_end.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/test_single_end.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/default.nf.test' contains outdir parameter
  • nf_test_content - 'tests/default.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/default.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/test_hybrid.nf.test' contains outdir parameter
  • nf_test_content - 'tests/test_hybrid.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/test_hybrid.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/test_minimal.nf.test' contains outdir parameter
  • nf_test_content - 'tests/test_minimal.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/test_minimal.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/test_assembly_input.nf.test' contains outdir parameter
  • nf_test_content - 'tests/test_assembly_input.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/test_longreadonly.nf.test' contains outdir parameter
  • nf_test_content - 'tests/test_longreadonly.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/test_longreadonly.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' contains outdir parameter
  • nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/test_alternatives.nf.test' contains outdir parameter
  • nf_test_content - 'tests/test_alternatives.nf.test' snapshots a 'versions.yml' file
  • nf_test_content - 'tests/nextflow.config' contains modules_testdata_base_path
  • nf_test_content - 'tests/nextflow.config' contains pipelines_testdata_base_path
  • nf_test_content - 'nf-test.config' sets a testsDir
  • nf_test_content - 'nf-test.config' sets a workDir
  • nf_test_content - 'nf-test.config' sets a configFile
  • files_unchanged - .gitattributes matches the template
  • files_unchanged - .prettierrc.yml matches the template
  • files_unchanged - CODE_OF_CONDUCT.md matches the template
  • files_unchanged - LICENSE matches the template
  • files_unchanged - .github/.dockstore.yml matches the template
  • files_unchanged - .github/CONTRIBUTING.md matches the template
  • files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
  • files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
  • files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
  • files_unchanged - .github/workflows/branch.yml matches the template
  • files_unchanged - .github/workflows/linting_comment.yml matches the template
  • files_unchanged - .github/workflows/linting.yml matches the template
  • files_unchanged - assets/email_template.html matches the template
  • files_unchanged - assets/email_template.txt matches the template
  • files_unchanged - assets/sendmail_template.txt matches the template
  • files_unchanged - assets/nf-core-mag_logo_light.png matches the template
  • files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
  • files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
  • files_unchanged - docs/README.md matches the template
  • files_unchanged - .gitignore matches the template
  • files_unchanged - .prettierignore matches the template
  • actions_nf_test - '.github/workflows/nf-test.yml' is triggered on expected events
  • actions_nf_test - '.github/workflows/nf-test.yml' checks minimum NF version
  • actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
  • actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
  • actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
  • readme - README Nextflow minimum version badge matched config. Badge: 25.04.2, Config: 25.04.2
  • readme - README nf-core template version badge found.
  • readme - README Zenodo placeholder was replaced with DOI.
  • pipeline_if_empty_null - No ifEmpty(null) strings found
  • plugin_includes - No wrong validation plugin imports have been found
  • pipeline_name_conventions - Name adheres to nf-core convention
  • template_strings - Did not find any Jinja template strings (0 files)
  • schema_lint - Schema lint passed
  • schema_lint - Schema title + description lint passed
  • schema_lint - Input mimetype lint passed: 'text/csv'
  • schema_params - Schema matched params returned from nextflow config
  • system_exit - No System.exit calls found
  • actions_schema_validation - Workflow validation passed: linting.yml
  • actions_schema_validation - Workflow validation passed: download_pipeline.yml
  • actions_schema_validation - Workflow validation passed: template-version-comment.yml
  • actions_schema_validation - Workflow validation passed: linting_comment.yml
  • actions_schema_validation - Workflow validation passed: release-announcements.yml
  • actions_schema_validation - Workflow validation passed: fix_linting.yml
  • actions_schema_validation - Workflow validation passed: nf-test.yml
  • actions_schema_validation - Workflow validation passed: awsfulltest.yml
  • actions_schema_validation - Workflow validation passed: branch.yml
  • actions_schema_validation - Workflow validation passed: awstest.yml
  • actions_schema_validation - Workflow validation passed: clean-up.yml
  • merge_markers - No merge markers found in pipeline files
  • modules_json - Only installed modules found in modules.json
  • multiqc_config - assets/multiqc_config.yml found and not ignored.
  • multiqc_config - assets/multiqc_config.yml contains report_section_order
  • multiqc_config - assets/multiqc_config.yml contains export_plots
  • multiqc_config - assets/multiqc_config.yml contains report_comment
  • multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
  • multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
  • multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
  • modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
  • local_component_structure - local subworkflows directory structure is correct 'subworkflows/local/TOOL/SUBTOOL'
  • base_config - conf/base.config found and not ignored.
  • base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
  • base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
  • base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
  • base_config - PORECHOP_PORECHOP found in conf/base.config and Nextflow scripts.
  • base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
  • base_config - FILTLONG found in conf/base.config and Nextflow scripts.
  • base_config - CATPACK_BINS found in conf/base.config and Nextflow scripts.
  • base_config - CATPACK_CONTIGS found in conf/base.config and Nextflow scripts.
  • base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
  • base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
  • base_config - METASPADES found in conf/base.config and Nextflow scripts.
  • base_config - METASPADESHYBRID found in conf/base.config and Nextflow scripts.
  • base_config - METAMDBG_ASM found in conf/base.config and Nextflow scripts.
  • base_config - FLYE found in conf/base.config and Nextflow scripts.
  • base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
  • base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
  • base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
  • base_config - MAG_DEPTHS_PLOT found in conf/base.config and Nextflow scripts.
  • base_config - BUSCO_BUSCO found in conf/base.config and Nextflow scripts.
  • base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
  • base_config - COMEBIN_RUNCOMEBIN found in conf/base.config and Nextflow scripts.
  • base_config - METABINNER_METABINNER found in conf/base.config and Nextflow scripts.
  • base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
  • base_config - CHECKM_LINEAGEWF found in conf/base.config and Nextflow scripts.
  • base_config - CHECKM2_PREDICT found in conf/base.config and Nextflow scripts.
  • modules_config - conf/modules.config found and not ignored.
  • modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
  • modules_config - FASTP found in conf/modules.config and Nextflow scripts.
  • modules_config - TRIMMOMATIC found in conf/modules.config and Nextflow scripts.
  • modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
  • modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
  • modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
  • modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
  • modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
  • modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
  • modules_config - PORECHOP_PORECHOP found in conf/modules.config and Nextflow scripts.
  • modules_config - PORECHOP_ABI found in conf/modules.config and Nextflow scripts.
  • modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
  • modules_config - NANOQ found in conf/modules.config and Nextflow scripts.
  • modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
  • modules_config - CHOPPER found in conf/modules.config and Nextflow scripts.
  • modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
  • modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
  • modules_config - MINIMAP2_HOST_INDEX found in conf/modules.config and Nextflow scripts.
  • modules_config - MINIMAP2_HOST_ALIGN found in conf/modules.config and Nextflow scripts.
  • modules_config - MINIMAP2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
  • modules_config - SAMTOOLS_HOSTREMOVED_UNMAPPED found in conf/modules.config and Nextflow scripts.
  • modules_config - SAMTOOLS_HOSTREMOVED_STATS found in conf/modules.config and Nextflow scripts.
  • modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
  • modules_config - METASPADES found in conf/modules.config and Nextflow scripts.
  • modules_config - METASPADESHYBRID found in conf/modules.config and Nextflow scripts.
  • modules_config - FLYE found in conf/modules.config and Nextflow scripts.
  • modules_config - METAMDBG_ASM found in conf/modules.config and Nextflow scripts.
  • modules_config - QUAST found in conf/modules.config and Nextflow scripts.
  • modules_config - QUAST_BINS found in conf/modules.config and Nextflow scripts.
  • modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
  • modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
  • modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
  • modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
  • modules_config - BUSCO_UNTAR found in conf/modules.config and Nextflow scripts.
  • modules_config - BUSCO_BUSCO found in conf/modules.config and Nextflow scripts.
  • modules_config - CHECKM_UNTAR found in conf/modules.config and Nextflow scripts.
  • modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
  • modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
  • modules_config - CONCAT_BUSCO_TSV found in conf/modules.config and Nextflow scripts.
  • modules_config - CHECKM2_DATABASEDOWNLOAD found in conf/modules.config and Nextflow scripts.
  • modules_config - CHECKM2_PREDICT found in conf/modules.config and Nextflow scripts.
  • modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
  • modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
  • modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
  • modules_config - CATPACK_PREPARE found in conf/modules.config and Nextflow scripts.
  • modules_config - CATPACK_BINS found in conf/modules.config and Nextflow scripts.
  • modules_config - CATPACK_ADDNAMES_BINS found in conf/modules.config and Nextflow scripts.
  • modules_config - CATPACK_SUMMARISE_BINS found in conf/modules.config and Nextflow scripts.
  • modules_config - CATPACK_UNBINS found in conf/modules.config and Nextflow scripts.
  • modules_config - CATPACK_ADDNAMES_UNBINS found in conf/modules.config and Nextflow scripts.
  • modules_config - CATPACK_SUMMARISE_UNBINS found in conf/modules.config and Nextflow scripts.
  • modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
  • modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
  • modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
  • modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
  • modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
  • modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
  • modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
  • modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
  • modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
  • modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
  • modules_config - SUMMARISEPYDAMAGE found in conf/modules.config and Nextflow scripts.
  • modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
  • modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS_SHORTREAD found in conf/modules.config and Nextflow scripts.
  • modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS_LONGREAD found in conf/modules.config and Nextflow scripts.
  • modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
  • modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
  • modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
  • modules_config - CONCOCT_CUTUPFASTA found in conf/modules.config and Nextflow scripts.
  • modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
  • modules_config - COMEBIN_RUNCOMEBIN found in conf/modules.config and Nextflow scripts.
  • modules_config - METABINNER_KMER found in conf/modules.config and Nextflow scripts.
  • modules_config - METABINNER_TOOSHORT found in conf/modules.config and Nextflow scripts.
  • modules_config - METABINNER_METABINNER found in conf/modules.config and Nextflow scripts.
  • modules_config - METABINNER_BINS found in conf/modules.config and Nextflow scripts.
  • modules_config - SEMIBIN_SINGLEEASYBIN found in conf/modules.config and Nextflow scripts.
  • modules_config - SEQKIT_STATS found in conf/modules.config and Nextflow scripts.
  • modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
  • modules_config - DASTOOL_FASTATOCONTIG2BIN_METABAT2 found in conf/modules.config and Nextflow scripts.
  • modules_config - DASTOOL_FASTATOCONTIG2BIN_MAXBIN2 found in conf/modules.config and Nextflow scripts.
  • modules_config - DASTOOL_FASTATOCONTIG2BIN_CONCOCT found in conf/modules.config and Nextflow scripts.
  • modules_config - DASTOOL_FASTATOCONTIG2BIN_COMEBIN found in conf/modules.config and Nextflow scripts.
  • modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
  • modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
  • modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
  • modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
  • modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
  • modules_config - CONCAT_TIARA_TSV found in conf/modules.config and Nextflow scripts.
  • modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
  • modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
  • modules_config - SUMMARISEPYDAMAGE found in conf/modules.config and Nextflow scripts.
  • modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
  • modules_config - BIGMAG found in conf/modules.config and Nextflow scripts.
  • nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
  • nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 3.5.1
  • rocrate_readme_sync - RO-Crate descriptions are in sync with README.md.

Run details

  • nf-core/tools version 3.5.1
  • Run at 2025-12-03 13:11:21

github-actions[bot] avatar Jun 22 '25 05:06 github-actions[bot]

[!WARNING] Newer version of the nf-core template is available.

Your pipeline is using an old version of the nf-core template: 3.4.1. Please update your pipeline to the latest version.

For more documentation on how to update your pipeline, please see the nf-core documentation and Synchronisation documentation.

nf-core-bot avatar Sep 05 '25 09:09 nf-core-bot

@nf-core-bot fix linting

jfy133 avatar Sep 12 '25 13:09 jfy133

TODO:

  • Veirfy the reordering of contigs is correct
  • Update output.md
  • Update/fix snapshots

jfy133 avatar Sep 12 '25 13:09 jfy133

Update:

  • My original tests were too simplistic,
  • ✅ I realised the join wasn't working properly because we can have one contig in multiple bins, so in the last PR I switched to a combine instead
  • TODO: I will need to 'clean' the keys before the join to drop anything after the first as MetaBinner keeps the MEGAHIT headers but the other binners appear to drop them (MetaBAT2, MetaBinner), prventing joining
  • TODO: the current test seems to run through without executing the pydamage bin summaries so I will need to continue investgating (I think due to a join failure in the creation of ch_pydamage_to_bins in pydamage_bins

jfy133 avatar Nov 18 '25 13:11 jfy133

TODO

  • Fixed the issues from before, and now can produce the reordered and a summary file, however I'm getting variable numbers of rows in the pydamage summary and number of reordered files per -resume run (it appears to be two different values that it flip flops between). To investigate:
    • Check contents of each reordered file before summarizing
    • Set up sorting of all relevant channels
    • I notice SUMMARISE_PYDAMAGE doesn't get cached again implying it is not recieveing the same number of rows each time
    • I should try an nf-consule reprex
  • Triple check manually that the median summaries make sense by manually getting the rows from original pydamage results and manually getting contig IDs from bins and 'manually' calculate median pydamage results
    • I am wondering if there is some consuming during combine (it's not doing a true all-by-all combine, but once one key is used it discards the rest?)
  • Test with CONCOCT
  • Add to a relevant test and update snapshot

jfy133 avatar Nov 21 '25 16:11 jfy133

@nf-core-bot fix linting

jfy133 avatar Nov 21 '25 16:11 jfy133

I realise now I have made this overly complicated, I think I can basically have a single local module with a custom script that does the reordering (as we actually rename the pydamage output files to make them unique)... so will start again

jfy133 avatar Nov 26 '25 04:11 jfy133

Latest status: nextflow code is mostly working, now trying to get the summarise_pydamage.py script working.

Last time however I found there was some discreprencey, where there were a lot fo bins missing in one of the files and I'm not sure why

jfy133 avatar Dec 03 '25 13:12 jfy133