mag icon indicating copy to clipboard operation
mag copied to clipboard

Published 20 hours ago • verified publisher icon nf-core

Post 3.2.0 release version bump

Open jfy133 opened this issue 1 year ago • 1 comments

PR checklist

  • [ ] This comment contains a description of changes (with reason).
  • [ ] If you've fixed a bug or added code that should be tested, add tests!
  • [ ] If you've added a new tool - have you followed the pipeline conventions in the contribution docs
  • [ ] If necessary, also make a PR on the nf-core/mag branch on the nf-core/test-datasets repository.
  • [ ] Make sure your code lints (nf-core pipelines lint).
  • [ ] Ensure the test suite passes (nextflow run . -profile test,docker --outdir <OUTDIR>).
  • [ ] Check for unexpected warnings in debug mode (nextflow run . -profile debug,test,docker --outdir <OUTDIR>).
  • [ ] Usage Documentation in docs/usage.md is updated.
  • [ ] Output Documentation in docs/output.md is updated.
  • [ ] CHANGELOG.md is updated.
  • [ ] README.md is updated (including new tool citations and authors/contributors).

jfy133 avatar Oct 27 '24 15:10 jfy133

nf-core pipelines lint overall result: Passed :white_check_mark: :warning:

Posted for pipeline commit 5fbdda4

+| ✅ 319 tests passed       |+
#| ❔   2 tests were ignored |#
!| ❗   5 tests had warnings |!

:heavy_exclamation_mark: Test warnings:

  • pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
  • pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
  • pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
  • pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!
  • pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline

:grey_question: Tests ignored:

:white_check_mark: Tests passed:

  • files_exist - File found: .gitattributes
  • files_exist - File found: .gitignore
  • files_exist - File found: .nf-core.yml
  • files_exist - File found: .editorconfig
  • files_exist - File found: .prettierignore
  • files_exist - File found: .prettierrc.yml
  • files_exist - File found: CHANGELOG.md
  • files_exist - File found: CITATIONS.md
  • files_exist - File found: CODE_OF_CONDUCT.md
  • files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
  • files_exist - File found: nextflow_schema.json
  • files_exist - File found: nextflow.config
  • files_exist - File found: README.md
  • files_exist - File found: .github/.dockstore.yml
  • files_exist - File found: .github/CONTRIBUTING.md
  • files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
  • files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
  • files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
  • files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
  • files_exist - File found: .github/workflows/branch.yml
  • files_exist - File found: .github/workflows/ci.yml
  • files_exist - File found: .github/workflows/linting_comment.yml
  • files_exist - File found: .github/workflows/linting.yml
  • files_exist - File found: assets/email_template.html
  • files_exist - File found: assets/email_template.txt
  • files_exist - File found: assets/sendmail_template.txt
  • files_exist - File found: assets/nf-core-mag_logo_light.png
  • files_exist - File found: conf/modules.config
  • files_exist - File found: conf/test.config
  • files_exist - File found: conf/test_full.config
  • files_exist - File found: docs/images/nf-core-mag_logo_light.png
  • files_exist - File found: docs/images/nf-core-mag_logo_dark.png
  • files_exist - File found: docs/output.md
  • files_exist - File found: docs/README.md
  • files_exist - File found: docs/README.md
  • files_exist - File found: docs/usage.md
  • files_exist - File found: main.nf
  • files_exist - File found: assets/multiqc_config.yml
  • files_exist - File found: conf/base.config
  • files_exist - File found: conf/igenomes.config
  • files_exist - File found: conf/igenomes_ignored.config
  • files_exist - File found: .github/workflows/awstest.yml
  • files_exist - File found: .github/workflows/awsfulltest.yml
  • files_exist - File found: modules.json
  • files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
  • files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
  • files_exist - File not found check: .github/workflows/push_dockerhub.yml
  • files_exist - File not found check: .markdownlint.yml
  • files_exist - File not found check: .nf-core.yaml
  • files_exist - File not found check: .yamllint.yml
  • files_exist - File not found check: bin/markdown_to_html.r
  • files_exist - File not found check: conf/aws.config
  • files_exist - File not found check: docs/images/nf-core-mag_logo.png
  • files_exist - File not found check: lib/Checks.groovy
  • files_exist - File not found check: lib/Completion.groovy
  • files_exist - File not found check: lib/NfcoreTemplate.groovy
  • files_exist - File not found check: lib/Utils.groovy
  • files_exist - File not found check: lib/Workflow.groovy
  • files_exist - File not found check: lib/WorkflowMain.groovy
  • files_exist - File not found check: lib/WorkflowMag.groovy
  • files_exist - File not found check: parameters.settings.json
  • files_exist - File not found check: pipeline_template.yml
  • files_exist - File not found check: Singularity
  • files_exist - File not found check: lib/nfcore_external_java_deps.jar
  • files_exist - File not found check: .travis.yml
  • nextflow_config - Found nf-schema plugin
  • nextflow_config - Config variable found: manifest.name
  • nextflow_config - Config variable found: manifest.nextflowVersion
  • nextflow_config - Config variable found: manifest.description
  • nextflow_config - Config variable found: manifest.version
  • nextflow_config - Config variable found: manifest.homePage
  • nextflow_config - Config variable found: timeline.enabled
  • nextflow_config - Config variable found: trace.enabled
  • nextflow_config - Config variable found: report.enabled
  • nextflow_config - Config variable found: dag.enabled
  • nextflow_config - Config variable found: process.cpus
  • nextflow_config - Config variable found: process.memory
  • nextflow_config - Config variable found: process.time
  • nextflow_config - Config variable found: params.outdir
  • nextflow_config - Config variable found: params.input
  • nextflow_config - Config variable found: validation.help.enabled
  • nextflow_config - Config variable found: manifest.mainScript
  • nextflow_config - Config variable found: timeline.file
  • nextflow_config - Config variable found: trace.file
  • nextflow_config - Config variable found: report.file
  • nextflow_config - Config variable found: dag.file
  • nextflow_config - Config variable found: validation.help.beforeText
  • nextflow_config - Config variable found: validation.help.afterText
  • nextflow_config - Config variable found: validation.help.command
  • nextflow_config - Config variable found: validation.summary.beforeText
  • nextflow_config - Config variable found: validation.summary.afterText
  • nextflow_config - Config variable (correctly) not found: params.nf_required_version
  • nextflow_config - Config variable (correctly) not found: params.container
  • nextflow_config - Config variable (correctly) not found: params.singleEnd
  • nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
  • nextflow_config - Config variable (correctly) not found: params.name
  • nextflow_config - Config variable (correctly) not found: params.enable_conda
  • nextflow_config - Config variable (correctly) not found: params.max_cpus
  • nextflow_config - Config variable (correctly) not found: params.max_memory
  • nextflow_config - Config variable (correctly) not found: params.max_time
  • nextflow_config - Config variable (correctly) not found: params.validationFailUnrecognisedParams
  • nextflow_config - Config variable (correctly) not found: params.validationLenientMode
  • nextflow_config - Config variable (correctly) not found: params.validationSchemaIgnoreParams
  • nextflow_config - Config variable (correctly) not found: params.validationShowHiddenParams
  • nextflow_config - Config timeline.enabled had correct value: true
  • nextflow_config - Config report.enabled had correct value: true
  • nextflow_config - Config trace.enabled had correct value: true
  • nextflow_config - Config dag.enabled had correct value: true
  • nextflow_config - Config manifest.name began with nf-core/
  • nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
  • nextflow_config - Config dag.file ended with .html
  • nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
  • nextflow_config - Config manifest.version ends in dev: 3.3.0dev
  • nextflow_config - Config params.custom_config_version is set to master
  • nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
  • nextflow_config - Lines for loading custom profiles found
  • nextflow_config - nextflow.config contains configuration profile test
  • nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
  • nextflow_config - Config default value correct: params.custom_config_version= master
  • nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
  • nextflow_config - Config default value correct: params.publish_dir_mode= copy
  • nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
  • nextflow_config - Config default value correct: params.validate_params= true
  • nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
  • nextflow_config - Config default value correct: params.spades_fix_cpus= -1
  • nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
  • nextflow_config - Config default value correct: params.metabat_rng_seed= 1
  • nextflow_config - Config default value correct: params.clip_tool= fastp
  • nextflow_config - Config default value correct: params.reads_minlength= 15
  • nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
  • nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
  • nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
  • nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
  • nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
  • nextflow_config - Config default value correct: params.bbnorm_target= 100
  • nextflow_config - Config default value correct: params.bbnorm_min= 5
  • nextflow_config - Config default value correct: params.longreads_min_length= 1000
  • nextflow_config - Config default value correct: params.longreads_keep_percent= 90
  • nextflow_config - Config default value correct: params.longreads_length_weight= 10
  • nextflow_config - Config default value correct: params.longread_adaptertrimming_tool= porechop_abi
  • nextflow_config - Config default value correct: params.gtdb_db= https://data.gtdb.ecogenomic.org/releases/release220/220.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r220_data.tar.gz
  • nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
  • nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
  • nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
  • nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
  • nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1
  • nextflow_config - Config default value correct: params.genomad_min_score= 0.7
  • nextflow_config - Config default value correct: params.genomad_splits= 1
  • nextflow_config - Config default value correct: params.binning_map_mode= group
  • nextflow_config - Config default value correct: params.min_contig_size= 1500
  • nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
  • nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
  • nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
  • nextflow_config - Config default value correct: params.tiara_min_length= 3000
  • nextflow_config - Config default value correct: params.binqc_tool= busco
  • nextflow_config - Config default value correct: params.checkm_download_url= https://zenodo.org/records/7401545/files/checkm_data_2015_01_16.tar.gz
  • nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
  • nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
  • nextflow_config - Config default value correct: params.gunc_database_type= progenomes
  • nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
  • nextflow_config - Config default value correct: params.freebayes_ploidy= 1
  • nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
  • nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
  • nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
  • nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
  • nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
  • files_unchanged - .gitattributes matches the template
  • files_unchanged - .prettierrc.yml matches the template
  • files_unchanged - CODE_OF_CONDUCT.md matches the template
  • files_unchanged - LICENSE matches the template
  • files_unchanged - .github/.dockstore.yml matches the template
  • files_unchanged - .github/CONTRIBUTING.md matches the template
  • files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
  • files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
  • files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
  • files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
  • files_unchanged - .github/workflows/branch.yml matches the template
  • files_unchanged - .github/workflows/linting_comment.yml matches the template
  • files_unchanged - .github/workflows/linting.yml matches the template
  • files_unchanged - assets/email_template.html matches the template
  • files_unchanged - assets/email_template.txt matches the template
  • files_unchanged - assets/sendmail_template.txt matches the template
  • files_unchanged - assets/nf-core-mag_logo_light.png matches the template
  • files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
  • files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
  • files_unchanged - docs/README.md matches the template
  • files_unchanged - .gitignore matches the template
  • files_unchanged - .prettierignore matches the template
  • actions_ci - '.github/workflows/ci.yml' is triggered on expected events
  • actions_ci - '.github/workflows/ci.yml' checks minimum NF version
  • actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
  • actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
  • actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
  • readme - README Nextflow minimum version badge matched config. Badge: 24.04.2, Config: 24.04.2
  • readme - README Zenodo placeholder was replaced with DOI.
  • plugin_includes - No wrong validation plugin imports have been found
  • pipeline_name_conventions - Name adheres to nf-core convention
  • template_strings - Did not find any Jinja template strings (0 files)
  • schema_lint - Schema lint passed
  • schema_lint - Schema title + description lint passed
  • schema_lint - Input mimetype lint passed: 'text/csv'
  • schema_params - Schema matched params returned from nextflow config
  • system_exit - No System.exit calls found
  • actions_schema_validation - Workflow validation passed: linting.yml
  • actions_schema_validation - Workflow validation passed: branch.yml
  • actions_schema_validation - Workflow validation passed: fix-linting.yml
  • actions_schema_validation - Workflow validation passed: release-announcements.yml
  • actions_schema_validation - Workflow validation passed: awsfulltest.yml
  • actions_schema_validation - Workflow validation passed: template_version_comment.yml
  • actions_schema_validation - Workflow validation passed: download_pipeline.yml
  • actions_schema_validation - Workflow validation passed: ci.yml
  • actions_schema_validation - Workflow validation passed: clean-up.yml
  • actions_schema_validation - Workflow validation passed: awstest.yml
  • actions_schema_validation - Workflow validation passed: linting_comment.yml
  • merge_markers - No merge markers found in pipeline files
  • modules_json - Only installed modules found in modules.json
  • multiqc_config - assets/multiqc_config.yml found and not ignored.
  • multiqc_config - assets/multiqc_config.yml contains report_section_order
  • multiqc_config - assets/multiqc_config.yml contains export_plots
  • multiqc_config - assets/multiqc_config.yml contains report_comment
  • multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
  • multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
  • multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
  • modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
  • base_config - conf/base.config found and not ignored.
  • base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
  • base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
  • base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
  • base_config - PORECHOP_PORECHOP found in conf/base.config and Nextflow scripts.
  • base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
  • base_config - FILTLONG found in conf/base.config and Nextflow scripts.
  • base_config - CENTRIFUGE_CENTRIFUGE found in conf/base.config and Nextflow scripts.
  • base_config - KRAKEN2 found in conf/base.config and Nextflow scripts.
  • base_config - KRONA_KTIMPORTTAXONOMY found in conf/base.config and Nextflow scripts.
  • base_config - CAT_DB_GENERATE found in conf/base.config and Nextflow scripts.
  • base_config - CAT found in conf/base.config and Nextflow scripts.
  • base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
  • base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
  • base_config - SPADES found in conf/base.config and Nextflow scripts.
  • base_config - SPADESHYBRID found in conf/base.config and Nextflow scripts.
  • base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
  • base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
  • base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
  • base_config - BUSCO found in conf/base.config and Nextflow scripts.
  • base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
  • base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
  • modules_config - conf/modules.config found and not ignored.
  • modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
  • modules_config - FASTP found in conf/modules.config and Nextflow scripts.
  • modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
  • modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
  • modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
  • modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
  • modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
  • modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
  • modules_config - PORECHOP_PORECHOP found in conf/modules.config and Nextflow scripts.
  • modules_config - PORECHOP_ABI found in conf/modules.config and Nextflow scripts.
  • modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
  • modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
  • modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
  • modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
  • modules_config - CENTRIFUGE_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
  • modules_config - CENTRIFUGE_KREPORT found in conf/modules.config and Nextflow scripts.
  • modules_config - KRAKEN2 found in conf/modules.config and Nextflow scripts.
  • modules_config - KREPORT2KRONA_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
  • modules_config - KRONA_KTIMPORTTAXONOMY found in conf/modules.config and Nextflow scripts.
  • modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
  • modules_config - METASPADES found in conf/modules.config and Nextflow scripts.
  • modules_config - METASPADESHYBRID found in conf/modules.config and Nextflow scripts.
  • modules_config - QUAST found in conf/modules.config and Nextflow scripts.
  • modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
  • modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
  • modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
  • modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
  • modules_config - BUSCO_DB_PREPARATION found in conf/modules.config and Nextflow scripts.
  • modules_config - BUSCO found in conf/modules.config and Nextflow scripts.
  • modules_config - BUSCO_SAVE_DOWNLOAD found in conf/modules.config and Nextflow scripts.
  • modules_config - BUSCO_SUMMARY found in conf/modules.config and Nextflow scripts.
  • modules_config - ARIA2_UNTAR found in conf/modules.config and Nextflow scripts.
  • modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
  • modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
  • modules_config - COMBINE_CHECKM_TSV found in conf/modules.config and Nextflow scripts.
  • modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
  • modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
  • modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
  • modules_config - CAT_DB_GENERATE found in conf/modules.config and Nextflow scripts.
  • modules_config - CAT found in conf/modules.config and Nextflow scripts.
  • modules_config - CAT_SUMMARY found in conf/modules.config and Nextflow scripts.
  • modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
  • modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
  • modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
  • modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
  • modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
  • modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
  • modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
  • modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
  • modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
  • modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
  • modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
  • modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS found in conf/modules.config and Nextflow scripts.
  • modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
  • modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
  • modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
  • modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
  • modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
  • modules_config - DASTOOL_FASTATOCONTIG2BIN_METABAT2 found in conf/modules.config and Nextflow scripts.
  • modules_config - DASTOOL_FASTATOCONTIG2BIN_MAXBIN2 found in conf/modules.config and Nextflow scripts.
  • modules_config - DASTOOL_FASTATOCONTIG2BIN_CONCOCT found in conf/modules.config and Nextflow scripts.
  • modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
  • modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
  • modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
  • modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
  • modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
  • modules_config - TIARA_SUMMARY found in conf/modules.config and Nextflow scripts.
  • modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
  • modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
  • modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
  • nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
  • nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 3.0.2

Run details

  • nf-core/tools version 3.0.2
  • Run at 2024-10-27 15:18:44

github-actions[bot] avatar Oct 27 '24 15:10 github-actions[bot]