mag
mag copied to clipboard
Added ability to auto-create samplesheet for nf-core/phageannotator
PR checklist
- [X] This comment contains a description of changes (with reason).
- [X] If you've fixed a bug or added code that should be tested, add tests!
- [X] If you've added a new tool - have you followed the pipeline conventions in the contribution docs
- [ ] If necessary, also make a PR on the nf-core/mag branch on the nf-core/test-datasets repository.
- [X] Make sure your code lints (
nf-core lint). - [X] Ensure the test suite passes (
nextflow run . -profile test,docker --outdir <OUTDIR>). - [ ] Usage Documentation in
docs/usage.mdis updated. - [ ] Output Documentation in
docs/output.mdis updated. - [x]
CHANGELOG.mdis updated. - [x]
README.mdis updated (including new tool citations and authors/contributors).
nf-core lint overall result: Failed :x:
Posted for pipeline commit 5b37df5
+| ✅ 201 tests passed |+
#| ❔ 2 tests were ignored |#
!| ❗ 4 tests had warnings |!
-| ❌ 10 tests failed |-
:x: Test failures:
- files_exist - File must be removed:
lib/Utils.groovy - files_exist - File must be removed:
lib/WorkflowMain.groovy - files_exist - File must be removed:
lib/NfcoreTemplate.groovy - files_exist - File must be removed:
lib/WorkflowMag.groovy - files_unchanged -
.github/CONTRIBUTING.mddoes not match the template - files_unchanged -
.github/PULL_REQUEST_TEMPLATE.mddoes not match the template - files_unchanged -
.github/workflows/branch.ymldoes not match the template - files_unchanged -
.github/workflows/linting_comment.ymldoes not match the template - files_unchanged -
.github/workflows/linting.ymldoes not match the template - files_unchanged -
pyproject.tomldoes not match the template
:heavy_exclamation_mark: Test warnings:
- pipeline_todos - TODO string in
main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome] - pipeline_todos - TODO string in
WorkflowMag.groovy: Optionally add in-text citation tools to this list. - pipeline_todos - TODO string in
methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline - schema_lint - Input mimetype is missing or empty
:grey_question: Tests ignored:
- nextflow_config - Config default ignored: params.phix_reference
- nextflow_config - Config default ignored: params.lambda_reference
:white_check_mark: Tests passed:
- files_exist - File found:
.gitattributes - files_exist - File found:
.gitignore - files_exist - File found:
.nf-core.yml - files_exist - File found:
.editorconfig - files_exist - File found:
.prettierignore - files_exist - File found:
.prettierrc.yml - files_exist - File found:
CHANGELOG.md - files_exist - File found:
CITATIONS.md - files_exist - File found:
CODE_OF_CONDUCT.md - files_exist - File found:
LICENSEorLICENSE.mdorLICENCEorLICENCE.md - files_exist - File found:
nextflow_schema.json - files_exist - File found:
nextflow.config - files_exist - File found:
README.md - files_exist - File found:
.github/.dockstore.yml - files_exist - File found:
.github/CONTRIBUTING.md - files_exist - File found:
.github/ISSUE_TEMPLATE/bug_report.yml - files_exist - File found:
.github/ISSUE_TEMPLATE/config.yml - files_exist - File found:
.github/ISSUE_TEMPLATE/feature_request.yml - files_exist - File found:
.github/PULL_REQUEST_TEMPLATE.md - files_exist - File found:
.github/workflows/branch.yml - files_exist - File found:
.github/workflows/ci.yml - files_exist - File found:
.github/workflows/linting_comment.yml - files_exist - File found:
.github/workflows/linting.yml - files_exist - File found:
assets/email_template.html - files_exist - File found:
assets/email_template.txt - files_exist - File found:
assets/sendmail_template.txt - files_exist - File found:
assets/nf-core-mag_logo_light.png - files_exist - File found:
conf/modules.config - files_exist - File found:
conf/test.config - files_exist - File found:
conf/test_full.config - files_exist - File found:
docs/images/nf-core-mag_logo_light.png - files_exist - File found:
docs/images/nf-core-mag_logo_dark.png - files_exist - File found:
docs/output.md - files_exist - File found:
docs/README.md - files_exist - File found:
docs/README.md - files_exist - File found:
docs/usage.md - files_exist - File found:
main.nf - files_exist - File found:
assets/multiqc_config.yml - files_exist - File found:
conf/base.config - files_exist - File found:
conf/igenomes.config - files_exist - File found:
.github/workflows/awstest.yml - files_exist - File found:
.github/workflows/awsfulltest.yml - files_exist - File found:
modules.json - files_exist - File found:
pyproject.toml - files_exist - File not found check:
Singularity - files_exist - File not found check:
parameters.settings.json - files_exist - File not found check:
pipeline_template.yml - files_exist - File not found check:
.nf-core.yaml - files_exist - File not found check:
bin/markdown_to_html.r - files_exist - File not found check:
conf/aws.config - files_exist - File not found check:
.github/workflows/push_dockerhub.yml - files_exist - File not found check:
.github/ISSUE_TEMPLATE/bug_report.md - files_exist - File not found check:
.github/ISSUE_TEMPLATE/feature_request.md - files_exist - File not found check:
docs/images/nf-core-mag_logo.png - files_exist - File not found check:
.markdownlint.yml - files_exist - File not found check:
.yamllint.yml - files_exist - File not found check:
lib/Checks.groovy - files_exist - File not found check:
lib/Completion.groovy - files_exist - File not found check:
lib/Workflow.groovy - files_exist - File not found check:
lib/nfcore_external_java_deps.jar - files_exist - File not found check:
.travis.yml - nextflow_config - Config variable found:
manifest.name - nextflow_config - Config variable found:
manifest.nextflowVersion - nextflow_config - Config variable found:
manifest.description - nextflow_config - Config variable found:
manifest.version - nextflow_config - Config variable found:
manifest.homePage - nextflow_config - Config variable found:
timeline.enabled - nextflow_config - Config variable found:
trace.enabled - nextflow_config - Config variable found:
report.enabled - nextflow_config - Config variable found:
dag.enabled - nextflow_config - Config variable found:
process.cpus - nextflow_config - Config variable found:
process.memory - nextflow_config - Config variable found:
process.time - nextflow_config - Config variable found:
params.outdir - nextflow_config - Config variable found:
params.input - nextflow_config - Config variable found:
params.validationShowHiddenParams - nextflow_config - Config variable found:
params.validationSchemaIgnoreParams - nextflow_config - Config variable found:
manifest.mainScript - nextflow_config - Config variable found:
timeline.file - nextflow_config - Config variable found:
trace.file - nextflow_config - Config variable found:
report.file - nextflow_config - Config variable found:
dag.file - nextflow_config - Config variable (correctly) not found:
params.nf_required_version - nextflow_config - Config variable (correctly) not found:
params.container - nextflow_config - Config variable (correctly) not found:
params.singleEnd - nextflow_config - Config variable (correctly) not found:
params.igenomesIgnore - nextflow_config - Config variable (correctly) not found:
params.name - nextflow_config - Config variable (correctly) not found:
params.enable_conda - nextflow_config - Config
timeline.enabledhad correct value:true - nextflow_config - Config
report.enabledhad correct value:true - nextflow_config - Config
trace.enabledhad correct value:true - nextflow_config - Config
dag.enabledhad correct value:true - nextflow_config - Config
manifest.namebegan withnf-core/ - nextflow_config - Config variable
manifest.homePagebegan with https://github.com/nf-core/ - nextflow_config - Config
dag.fileended with.html - nextflow_config - Config variable
manifest.nextflowVersionstarted with >= or !>= - nextflow_config - Config
manifest.versionends indev:2.5.5dev - nextflow_config - Config
params.custom_config_versionis set tomaster - nextflow_config - Config
params.custom_config_baseis set tohttps://raw.githubusercontent.com/nf-core/configs/master - nextflow_config - Lines for loading custom profiles found
- nextflow_config - nextflow.config contains configuration profile
test - nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
- nextflow_config - Config default value correct: params.custom_config_version= master
- nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
- nextflow_config - Config default value correct: params.max_cpus= 16
- nextflow_config - Config default value correct: params.max_memory= 128.GB
- nextflow_config - Config default value correct: params.max_time= 240.h
- nextflow_config - Config default value correct: params.publish_dir_mode= copy
- nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
- nextflow_config - Config default value correct: params.validate_params= true
- nextflow_config - Config default value correct: params.spades_fix_cpus= -1
- nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
- nextflow_config - Config default value correct: params.metabat_rng_seed= 1
- nextflow_config - Config default value correct: params.clip_tool= fastp
- nextflow_config - Config default value correct: params.reads_minlength= 15
- nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
- nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
- nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
- nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
- nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
- nextflow_config - Config default value correct: params.bbnorm_target= 100
- nextflow_config - Config default value correct: params.bbnorm_min= 5
- nextflow_config - Config default value correct: params.longreads_min_length= 1000
- nextflow_config - Config default value correct: params.longreads_keep_percent= 90
- nextflow_config - Config default value correct: params.longreads_length_weight= 10
- nextflow_config - Config default value correct: params.gtdb_db= https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/auxillary_files/gtdbtk_r214_data.tar.gz
- nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
- nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
- nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
- nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
- nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1.0
- nextflow_config - Config default value correct: params.gtdbtk_pplacer_scratch= true
- nextflow_config - Config default value correct: params.genomad_min_score= 0.7
- nextflow_config - Config default value correct: params.genomad_splits= 1
- nextflow_config - Config default value correct: params.binning_map_mode= group
- nextflow_config - Config default value correct: params.min_contig_size= 1500
- nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
- nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
- nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
- nextflow_config - Config default value correct: params.tiara_min_length= 3000
- nextflow_config - Config default value correct: params.binqc_tool= busco
- nextflow_config - Config default value correct: params.checkm_download_url= https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz
- nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
- nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
- nextflow_config - Config default value correct: params.gunc_database_type= progenomes
- nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
- nextflow_config - Config default value correct: params.freebayes_ploidy= 1
- nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
- nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
- nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
- nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
- nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
- files_unchanged -
.gitattributesmatches the template - files_unchanged -
.prettierrc.ymlmatches the template - files_unchanged -
CODE_OF_CONDUCT.mdmatches the template - files_unchanged -
LICENSEmatches the template - files_unchanged -
.github/.dockstore.ymlmatches the template - files_unchanged -
.github/ISSUE_TEMPLATE/bug_report.ymlmatches the template - files_unchanged -
.github/ISSUE_TEMPLATE/config.ymlmatches the template - files_unchanged -
.github/ISSUE_TEMPLATE/feature_request.ymlmatches the template - files_unchanged -
assets/email_template.htmlmatches the template - files_unchanged -
assets/email_template.txtmatches the template - files_unchanged -
assets/sendmail_template.txtmatches the template - files_unchanged -
assets/nf-core-mag_logo_light.pngmatches the template - files_unchanged -
docs/images/nf-core-mag_logo_light.pngmatches the template - files_unchanged -
docs/images/nf-core-mag_logo_dark.pngmatches the template - files_unchanged -
docs/README.mdmatches the template - files_unchanged -
.gitignorematches the template - files_unchanged -
.prettierignorematches the template - actions_ci - '.github/workflows/ci.yml' is triggered on expected events
- actions_ci - '.github/workflows/ci.yml' checks minimum NF version
- actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
- actions_awsfulltest -
.github/workflows/awsfulltest.ymlis triggered correctly - actions_awsfulltest -
.github/workflows/awsfulltest.ymldoes not use-profile test - readme - README Nextflow minimum version badge matched config. Badge:
23.04.0, Config:23.04.0 - readme - README Zenodo placeholder was replaced with DOI.
- pipeline_name_conventions - Name adheres to nf-core convention
- template_strings - Did not find any Jinja template strings (254 files)
- schema_lint - Schema lint passed
- schema_lint - Schema title + description lint passed
- schema_params - Schema matched params returned from nextflow config
- system_exit - No
System.exitcalls found - actions_schema_validation - Workflow validation passed: awstest.yml
- actions_schema_validation - Workflow validation passed: branch.yml
- actions_schema_validation - Workflow validation passed: ci.yml
- actions_schema_validation - Workflow validation passed: clean-up.yml
- actions_schema_validation - Workflow validation passed: fix-linting.yml
- actions_schema_validation - Workflow validation passed: release-announcements.yml
- actions_schema_validation - Workflow validation passed: linting.yml
- actions_schema_validation - Workflow validation passed: awsfulltest.yml
- actions_schema_validation - Workflow validation passed: linting_comment.yml
- actions_schema_validation - Workflow validation passed: download_pipeline.yml
- merge_markers - No merge markers found in pipeline files
- modules_json - Only installed modules found in
modules.json - multiqc_config - 'assets/multiqc_config.yml' contains
report_section_order - multiqc_config - 'assets/multiqc_config.yml' contains
export_plots - multiqc_config - 'assets/multiqc_config.yml' contains
report_comment - multiqc_config - 'assets/multiqc_config.yml' follows the ordering scheme of the minimally required plugins.
- multiqc_config - 'assets/multiqc_config.yml' contains a matching 'report_comment'.
- multiqc_config - 'assets/multiqc_config.yml' contains 'export_plots: true'.
- modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
Run details
- nf-core/tools version 2.13.1
- Run at
2024-04-30 20:21:42
@nf-core-bot fix linting
Regarding your questions:
- I think it would be a good idea to create an umbrella workflow for generating samplesheets for any downstream nf-core pipeline
- Great suggestion, I will make that change
- It is possible that they would want to keep them separate, so I can make that an option!