Majid Mosayebi comments

Repositories
Issues
Comments

Results 3 comments of


                                            Majid Mosayebi

Are pocket restraints with affinity prediction working?

@jwohlwend Do you have any updates or possible workarounds for this issue?

Optional rosetta repacking and fastrelax

You’re right that PyRosetta is only free for academic use, and purchasing a license is needed for commercial use. However, for those who already have a PyRosetta license, incorporating Rosetta...

Enforcing contacts on RNA

Hi, I’d like to raise this issue again using a slightly different RNA sequence: `GCUUUUCGCACACAGCUACAGUGUUGAGC` ViennaRNA predicts multiple conformations for this sequence, for example: ``` ((((...((((.........)))).)))) (−4.86 kcal/mol) ((((..(((...........)))..)))) (−4.49...