wgsim
wgsim copied to clipboard
read simulation for reverse and forward offset is not consistent.
Hi,
As mention above in the title. Read simulation for reverse and forward mutation offset is not consistent. Please check.
Example:
gi|224589813|ref|NC_000021.8|_9440728_9441261_0:0:1_0:0:0_42167/2 (forward) ATGTCAAGATAATGTCAGAAATTCTTTACAATTGCTTCCAGAAGGAGTAGCCTTTTGATCTAGTGCACAGGTGTCCAGTC (TTTTA) GGCTTCTTAGGGCCA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@gi|224589813|ref|NC_000021.8|_9440248_9440824_0:0:0_0:0:1_93e94/1 (reverse) GCCCTAAGAAGCC (ATAAA) GACTGGACACCTGTGCACTAGATCAAAAGGCTACTCCTTCTGGAAGCAATTGTAAAGAATTTCTGACATTATCTTGACATGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
simulated insert gi|224589813|ref|NC_000021.8| 9440811 - A +
What is the problem? I do not see.
Look at the forward read with simulation read of C(TTTTA)GGC and reverse read is GCC(ATAAA)G.
It is inconsistent.
From wgsim output, pileup format show: 21 9440811 - A +
Hi, tried using wgsim and encountered the exact problem as what reported by jozerffer. Perhaps, I can give a more visual description of the problem as follows (monospaced font would illustrate it a lot better):
Read 1: forward, has an A inserted at the 85th base of the read (represented below with an uppercase) 80 cttttAggctt 90 9440807 ctttt-ggctt 9440816
Read 2: reverse, has a T inserted at the 15th base of the read (represented below with an uppercase) 10 agccaTaaaga 20 9440815 agcca-aaaga 9440806
If, referring to the sim list of insertions, I would think that Read 2 should be
10 agccTaaaga 20
Your prompt reply to this post is much appreciated.
Thanks, James
I'm seeing something similar. All (-)-strand reads have two or more nts upstream of their indel, reversed with respect to those on the (+)-strand:
In the following alignment:
GC_C_CG .. . .. CGC_CACG CGC_CACG CGC_CACG CGC_CACG cgcac_cg cgcac_cg cgcac_cg cgcac_cg
the forward -CA becomes AC- on the reverse strand.
I also have a feature request: output a SAM/BAM file with the true alignments (CIGAR+MD tag) .
Duh I just noticed this too late. It may be the same bug I just fixed in the samtools version:
https://github.com/samtools/samtools/pull/428