bwa icon indicating copy to clipboard operation
bwa copied to clipboard

Working sample

Open Theldus opened this issue 8 years ago • 0 comments

Hello, I'm using the bwa-0.7.17, and I'm finding some issues when executing the program, my sequence: ./bwa index genome.fasta ./bwa mem genome.fasta input.fasta

I do not completely understand how it works:

  • bwa is able to load FASTA files as input?
  • if only FASTQ, how is the file's format? our format is something like this:
@L182:154:C91VYACXX:2:1101:1105:2128 1:N:0:2
NGAACAAGTTGCAGAGTCCTCCTGGCGCTGAGCTTAACGACCTGGCAGGTCTCTTCCATTGCTAGGTTGGGTCTGTGGGATAGGTTGTGCATCAATGTCAT
+
#0<FFFFFFFFFFIFFIIIIFFIIIFIIIIFFIFFII<FBFIIIIFFIIFFFFFFBF7BF<BBBFFBFB<B<BB<BB7B'<<BB<BB7BBBBBBBBBFB<B
@L182:154:C91VYACXX:2:1101:1151:2132 1:N:0:2
NCCATGACATGCAGAAACTTCCAGGCATCCCCTCCAGACCATGGCAGCCCCACCCGCCGCTTTCCCTGGCCAGGAGAAAGTTGCTGCTGCACAGGAATGCC
+
#0<FFFFFFFFFFIIIIIIIIIIIIIIIIFIFFFIIIFIIIIIIFIIIIIIIIIIIIFFFBFFBFBFBFBFBBFF77BBBBBFFFFBBFBBBBFBBBFBBF

I want to know if could be possible to you provide me a input/output sample files that works to the following sequences of commands provided above.

Theldus avatar Dec 18 '17 19:12 Theldus