Results 35 issues of Kristoffer

Adding the request "Please make it a reusable library" from [here](https://twitter.com/akorobeynikov/status/1546794880453730305?s=20&t=Xq4h5jMrbF-hWlPuwvu7wQ). Not sure what it entails or mean.

feature

Hi Jeff, I'm posting this issue for a collaborator. We run into the error pasted below ``` Command "/anaconda3/bin/python -u -c "import setuptools, tokenize;__file__='/private/var/folders/x3/5tv3wm3n48q4ry3tct3mg3bw0000gn/T/pip-install- p6zwae25/parasail/setup.py';f=getattr(tokenize, 'open', open)(__file__);code=f.read().replace('\r\n', '\n');f.close();exec(compile(code, _file_, 'exec'))"...

Hi again Jeff, I was wondering if it's possible to implement any convex gap penalty function within this library? This is useful for alignment with longer gaps from exons or...

Currently hard coded to 500 from what I know. Could be good for development to keep this as a parameter and also print the current estimation (as discussed in email).

Something we brought up on today's discussion: 1. Having a parameter (`-H`, default 1000) to the threshold that determines the threshold for ignoring seeds. 2. Remove all seeds above the...

Posting from discussion in https://github.com/ksahlin/strobealign/pull/350#issuecomment-1742579627 Should we remove `q` and `Bitcount()` in the randstrobe linking function? `Bitcount()` uses popcount which seems computationally expensive compared to other link methods (I can...

We have our dros, maize, chm, and rye simulated reads and let that guide our development. Only at release stage we are typically running an evaluation on (2-3) bio datasets....

The pairwise alignment done in `rescue_mate` cuts out a much larger segment of the reference compared to when we can use seeds. This makes the pairwise alignment much slower for...

In order not to overfit for future parameter optimisation efforts (e.g., #272), it would be good to include: 1. A benchmark on a metagenomic dataset with several similar strains. 2....

Consider the following genome of three 20nt long chromosomes: ``` >chr1 AGACGCAGCGAGACGCAGCG >chr2 TGCGTTAGTACGATTGCATC >chr3 CCTTTAGTACGATTGCATCT ``` Instead of representing the seed location as e.g. (chr3, 10) for position 10...

optimization