Jeremy

I ended up exporting the data from the Seurat object and plotting using ggplot2

Request: in distance documentation, explicitly state if euclidean distance matrices are squared or not (ward.D is only appropriate for squared distances, whereas ward.D2 is appropriate for non-squared distances).

CATDKAGGLSDIQNP tgtgctactgataaggctggaggactaagtgacatccagaaccca

To clarify, I think we need to report the clonal size of out-of-frame CDR3s somewhere; it shouldn't impact the clonality estimates for in-frame CDR3s.

TCRdist is using allele-level information to calculate probabilities of generation, among other things. So at the stage of processing a parsed_seqs_file, it's looking for chains that can be explicitly found...

Ah, hrm... I'm still a bit confused on the current implementation of --ntCDR3. I did test out putting in just CDR3 sequences, but I had to decrease "thresh" for it...

Thanks for the explanation! I find that setting --P_ratio_thresh to 0.0 causes issues (every Pgen comes back as nan) but I can set it to extremely small values (e.g., 1E-10)...

Hi @qmarcou! Wanted to follow up on this after thinking about it... So I'm interested in using IGoR for estimating Pgen, but many of the sequences that exist for TCR...

Hi @benjjneb I came to this thread searching for info on how truncLen treats sequences of lengths truncLen both truncates to the specified length, and throws away any sequences