Nimesh

Results 2 issues of Nimesh

Hello, I'm trying to run bonito basecaller on Nvidia Jetson Nano, however, i'm experiencing a kbeam ImportError. -------- > loading model Traceback (most recent call last): File "/home/helix/bonito/venv3/bin/bonito", line 33,...

bug

Hi, I'm running the encoder tool (using macOS): adscodex % go run encode/main.go -dseqnum 3 -rseqnum 2 -etbl ~/ALTGOPATH/src/adscodex/tbl/h4g2-17-13.etbl \ -p3 CAGTGAGCTGGCAACTTCCA -p5 CGACATCTCGATGGCAGCAT $HOME/32kfilerand >> dna.out flag provided but...