githubgig

Hello, I'd like to use maskFastaFromBed to softmask the genome, but it doesn't consider strand information. Example run and output is below. **Input fasta file: genome.fasta** >Chr1 ATTGACAGAAATATCATCACATCTATTCTTTCTCTCCCCTAGTTTAGCAAAT >Chr2 GACATATAAATAATAGTGGGAAAGAGACCGGATGAAACCTCAACTGTGGCTTTCATTAACAGATCA...

Segmentation fault (core dumped), err code: 255

6

Hello, I have two questions: 1. I got _"Segmentation fault (core dumped)"_ message at bwa mem alignment step (the last few lines copied below my message and attached are params.txt...

ProcessRepeats .out file error?

4

Hello, I'm using RepeatMasker version 4.1.0, and as per the _weblink https://www.animalgenome.org/bioinfo/resources/manuals/RepeatMasker.html_, the .out file from ProcessRepeats should look as below with values in the 12th column in parantheses (representing...

Hello, When I use pychopper and consensus parameters, the sequence seems worse in all six frames somehow (see below). I understand the cluster sequences can't be compared one-to-one, these are...

Error 1017

6

Hello, I used snapp_prep.rb to generate the .xml file, but I am getting the below error in BEAST (v2.6.3). I have already installed SNAPP, so I am not sure which...