gilhornung

Failed to build biostar145820 (Build file '/jvarkit/build.gradle' line: 676)

1

### Verify * if you cannot compile/install , read https://github.com/lindenb/jvarkit/wiki/Compilation before submitting a new issue * the version of java ``` openjdk 11.0.11 2021-04-20 OpenJDK Runtime Environment (build 11.0.11+9-Ubuntu-0ubuntu2.18.04) OpenJDK...

Inconsistency between RNA sequence and protein sequence at the breakpoint

3

Hi Daniel, We noticed an inconsistency between the Fusion_sequence and the protein sequence. It is a fusion between HEG1 and SLC12A8, and the reported fusion sequence is ``` TCGGGATACTTTCAGTTCAACAAGATGGACCACTCCTGCCGAG*AACATGGTTTCATTGGATATTCACCCGAACTGCTACAGAACAA ```...

NNNN as ref allele

1

Hi Christoffer, Another bug: chr | start | end | reference | variant | inGene | severity | effect -- | -- | -- | -- | -- | --...

Scattering gemBS alignment step across a cluster

1

Hello, We are using Cromwell on a Google Cloud Platform to analyze sequencing data. We found that, at least for bwa and WGS, scattering the reads in small chunks across...

Hi, Is there a possibility to sort the reads by base in pileup.js? (The equivalent in IGV.js is ALT-click) Thank you, Gil Hornung

"TypeError: too many positional arguments" when running the example in readthedocs

1

When running the example in https://pyjudi.readthedocs.io/en/latest/judi-tasks.html I get the following error: ``` $ doit -f j.py /home/ubuntu/miniconda3/envs/genomics.py3/lib/python3.7/site-packages/tqdm/std.py:699: FutureWarning: The Panel class is removed from pandas. Accessing it from the top-level...