faulk-lab
faulk-lab
The solution might be to provide modkit with a .bed of target regions along with the bam, for calculating entropy in those regions as a whole. I think that's more...
I went back to the original Xie et al. 2011 paper where it was originally defined. They use 4 sites as an example to show the calculation, but everywhere else...
This regional method seems to be exactly what I'm looking for, except for an error in some bed files. I got the new version working with my two input bam...
Sure, here's one error and a sample of the bed file. I can upload other files if you tell me where. ``` (base) minknow@betsy:~/Desktop/entropy-test-chimp$ ./modkit-devel/modkit entropy --cpg --header -t 32...
Getting closer. Yes I should have said `--filter-threshold` not `--filter-percentile` Tried that and it also didn't work. Here's the results you asked for. I ran `modkit call-mods file.bam file.074.bam --filter-percentile...
Bumping this thread as I am seeing the same problem with 4.3 vs 5.0 model in downstream modkit. This defeats the purpose of automatic threshold detection. Do you have a...
I am having the same issue. Any fix?
That's exactly what it was danpal96. Once I created an output directory it worked fine. It should give a more informative error rather than just segfault for such a basic...
There's also an `@` in it?! `(base) minknow@pop-os:~/Desktop/alligator/ragtag_output$ sed -n '15809930p;15809931q' ragtag.scaffold.fix.80.fasta TGTTAGGGGAGGGCCAGAGGTCCAGAGATACAAGTAAGTGTTTAGGACAAAAGGAGAAAACAAAACATTTC@GATTTCAA`